Mutagenetix > Incidental Mutation

Incidental Mutation 'R2888:Sptbn2'

260017

Institutional Source

Beutler Lab

Gene Symbol

Sptbn2

Ensembl Gene

ENSMUSG00000067889

Gene Name

spectrin beta, non-erythrocytic 2

Synonyms

Spnb3

MMRRC Submission

040476-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2888 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4761195-4802388 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4798664 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1998 (T1998A)

Ref Sequence

ENSEMBL: ENSMUSP00000008991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008991] [ENSMUST00000178353]

AlphaFold

Q68FG2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000008991
AA Change: T1998A

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: T1998A

Domain	Start	End	E-Value	Type
CH	59	159	1.86e-28	SMART
CH	178	276	2.86e-20	SMART
SPEC	308	414	4.63e-1	SMART
SPEC	428	528	3.07e-23	SMART
SPEC	534	638	4.47e-25	SMART
SPEC	644	744	1.28e-25	SMART
SPEC	750	849	4.98e-23	SMART
SPEC	855	955	1.63e-18	SMART
SPEC	961	1062	1.45e-24	SMART
SPEC	1068	1169	4.15e-20	SMART
SPEC	1175	1275	5.26e-22	SMART
SPEC	1281	1380	1.17e-19	SMART
SPEC	1386	1485	2.06e-24	SMART
SPEC	1491	1585	1.74e-22	SMART
SPEC	1591	1691	5.42e-24	SMART
SPEC	1697	1798	2.1e-21	SMART
SPEC	1804	1904	5.47e-20	SMART
SPEC	1910	2010	1.99e-22	SMART
SPEC	2016	2256	2.92e-6	SMART
PH	2219	2330	1.65e-14	SMART
low complexity region	2373	2386	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178353

SMART Domains

Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

Domain	Start	End	E-Value	Type
RRM	2	69	1.96e-17	SMART
Pfam:RRM_1	81	118	5.6e-7	PFAM

Meta Mutation Damage Score

0.1033

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930480E11Rik	A	T	X: 77,414,288 (GRCm39)	I338F	probably damaging	Het
Acd	A	G	8: 106,425,470 (GRCm39)	S288P	probably benign	Het
Aimp2	T	C	5: 143,846,553 (GRCm39)		probably benign	Het
Atp8b2	T	C	3: 89,865,600 (GRCm39)	D100G	probably damaging	Het
Cacna1i	A	T	15: 80,258,968 (GRCm39)	I1226F	probably damaging	Het
Dsp	C	A	13: 38,376,224 (GRCm39)	N1336K	possibly damaging	Het
Extl2	T	C	3: 115,820,906 (GRCm39)	F251S	probably damaging	Het
Gusb	T	C	5: 130,029,343 (GRCm39)	H146R	probably damaging	Het
Itpr2	C	T	6: 146,072,791 (GRCm39)	G2380S	probably damaging	Het
Kansl1l	T	C	1: 66,763,764 (GRCm39)	K762E	probably benign	Het
Krtap4-9	C	A	11: 99,676,245 (GRCm39)	C55*	probably null	Het
Lamp1	T	A	8: 13,223,891 (GRCm39)	L341H	probably damaging	Het
Llcfc1	A	T	6: 41,661,537 (GRCm39)	K29M	probably damaging	Het
Malrd1	A	T	2: 16,079,568 (GRCm39)	I1762F	unknown	Het
Muc5b	G	A	7: 141,415,291 (GRCm39)	V2746M	probably damaging	Het
Mug1	T	A	6: 121,858,802 (GRCm39)	D1173E	probably benign	Het
Myo5b	G	C	18: 74,895,689 (GRCm39)	E1782Q	probably damaging	Het
Or2t46	T	C	11: 58,471,988 (GRCm39)	F106S	possibly damaging	Het
Pcdha5	A	G	18: 37,094,940 (GRCm39)	D483G	probably damaging	Het
Phex	T	C	X: 156,093,954 (GRCm39)	I439V	probably benign	Het
Pkd1l1	T	A	11: 8,897,251 (GRCm39)	S103C	probably damaging	Het
Plekha4	C	T	7: 45,187,668 (GRCm39)	R176C	probably damaging	Het
Ppp1r3a	T	G	6: 14,718,248 (GRCm39)	S889R	possibly damaging	Het
Pramel23	G	T	4: 143,423,460 (GRCm39)	T443K	probably benign	Het
Prol1	C	A	5: 88,476,168 (GRCm39)	A186E	unknown	Het
Rbm39	C	T	2: 156,009,503 (GRCm39)	R123H	probably benign	Het
Rtn4	T	C	11: 29,643,687 (GRCm39)	S167P	probably damaging	Het
Slc35a5	A	G	16: 44,971,923 (GRCm39)	C114R	probably damaging	Het
Smoc2	T	C	17: 14,617,887 (GRCm39)		probably null	Het
Tbc1d5	T	A	17: 51,242,577 (GRCm39)	E173D	probably damaging	Het
Tsc2	A	G	17: 24,850,969 (GRCm39)		probably null	Het
Umps	A	T	16: 33,784,240 (GRCm39)	V71E	probably damaging	Het
Vmn2r13	T	C	5: 109,339,840 (GRCm39)	D45G	possibly damaging	Het
Wdfy4	C	A	14: 32,831,476 (GRCm39)	E917*	probably null	Het
Zfhx2	T	C	14: 55,302,260 (GRCm39)	K1908R	possibly damaging	Het
Zfp511	A	C	7: 139,619,295 (GRCm39)	D204A	probably benign	Het

Other mutations in Sptbn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Sptbn2	APN	19	4,774,733 (GRCm39)	missense	possibly damaging	0.94
IGL00688:Sptbn2	APN	19	4,775,966 (GRCm39)	missense	probably damaging	1.00
IGL01339:Sptbn2	APN	19	4,796,000 (GRCm39)	nonsense	probably null
IGL01373:Sptbn2	APN	19	4,796,000 (GRCm39)	nonsense	probably null
IGL01420:Sptbn2	APN	19	4,784,153 (GRCm39)	missense	probably benign
IGL01456:Sptbn2	APN	19	4,796,777 (GRCm39)	missense	probably damaging	1.00
IGL01953:Sptbn2	APN	19	4,799,721 (GRCm39)	missense	probably benign
IGL03026:Sptbn2	APN	19	4,774,261 (GRCm39)	critical splice donor site	probably null
IGL03275:Sptbn2	APN	19	4,782,689 (GRCm39)	missense	possibly damaging	0.65
IGL03286:Sptbn2	APN	19	4,797,860 (GRCm39)	missense	probably damaging	0.97
F5770:Sptbn2	UTSW	19	4,800,660 (GRCm39)	missense	probably damaging	1.00
PIT4696001:Sptbn2	UTSW	19	4,795,605 (GRCm39)	missense	probably benign	0.00
R0046:Sptbn2	UTSW	19	4,795,405 (GRCm39)	intron	probably benign
R0046:Sptbn2	UTSW	19	4,795,405 (GRCm39)	intron	probably benign
R0121:Sptbn2	UTSW	19	4,795,321 (GRCm39)	missense	probably damaging	1.00
R0127:Sptbn2	UTSW	19	4,774,772 (GRCm39)	missense	probably damaging	1.00
R0212:Sptbn2	UTSW	19	4,796,970 (GRCm39)	critical splice donor site	probably null
R0277:Sptbn2	UTSW	19	4,795,173 (GRCm39)	missense	probably benign	0.28
R0417:Sptbn2	UTSW	19	4,787,954 (GRCm39)	missense	probably benign	0.01
R0457:Sptbn2	UTSW	19	4,795,966 (GRCm39)	missense	possibly damaging	0.89
R0536:Sptbn2	UTSW	19	4,776,718 (GRCm39)	missense	probably damaging	0.99
R0631:Sptbn2	UTSW	19	4,790,014 (GRCm39)	missense	probably benign	0.01
R0734:Sptbn2	UTSW	19	4,798,151 (GRCm39)	nonsense	probably null
R0742:Sptbn2	UTSW	19	4,769,011 (GRCm39)	missense	possibly damaging	0.46
R1195:Sptbn2	UTSW	19	4,795,921 (GRCm39)	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4,795,921 (GRCm39)	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4,795,921 (GRCm39)	missense	possibly damaging	0.85
R1364:Sptbn2	UTSW	19	4,782,693 (GRCm39)	missense	probably damaging	1.00
R1495:Sptbn2	UTSW	19	4,769,004 (GRCm39)	missense	possibly damaging	0.92
R1498:Sptbn2	UTSW	19	4,794,274 (GRCm39)	missense	possibly damaging	0.94
R1606:Sptbn2	UTSW	19	4,800,270 (GRCm39)	critical splice donor site	probably null
R1678:Sptbn2	UTSW	19	4,800,525 (GRCm39)	missense	probably damaging	1.00
R1746:Sptbn2	UTSW	19	4,795,992 (GRCm39)	nonsense	probably null
R1820:Sptbn2	UTSW	19	4,776,624 (GRCm39)	missense	probably damaging	0.98
R1830:Sptbn2	UTSW	19	4,782,569 (GRCm39)	missense	probably benign	0.09
R1863:Sptbn2	UTSW	19	4,782,713 (GRCm39)	missense	possibly damaging	0.54
R1967:Sptbn2	UTSW	19	4,795,327 (GRCm39)	missense	probably benign	0.00
R2085:Sptbn2	UTSW	19	4,788,587 (GRCm39)	missense	probably benign	0.09
R2301:Sptbn2	UTSW	19	4,784,166 (GRCm39)	missense	probably benign	0.00
R2310:Sptbn2	UTSW	19	4,768,963 (GRCm39)	missense	probably benign	0.19
R3788:Sptbn2	UTSW	19	4,795,950 (GRCm39)	missense	probably damaging	1.00
R4429:Sptbn2	UTSW	19	4,788,383 (GRCm39)	missense	probably damaging	1.00
R4536:Sptbn2	UTSW	19	4,782,630 (GRCm39)	missense	probably damaging	1.00
R4662:Sptbn2	UTSW	19	4,789,267 (GRCm39)	missense	probably damaging	1.00
R4672:Sptbn2	UTSW	19	4,782,524 (GRCm39)	missense	probably benign	0.25
R4731:Sptbn2	UTSW	19	4,792,508 (GRCm39)	missense	probably damaging	0.96
R4747:Sptbn2	UTSW	19	4,798,182 (GRCm39)	missense	probably benign	0.27
R4889:Sptbn2	UTSW	19	4,779,458 (GRCm39)	missense	possibly damaging	0.69
R4891:Sptbn2	UTSW	19	4,788,497 (GRCm39)	missense	probably damaging	1.00
R4965:Sptbn2	UTSW	19	4,779,337 (GRCm39)	missense	probably benign	0.13
R4968:Sptbn2	UTSW	19	4,779,230 (GRCm39)	splice site	probably null
R4981:Sptbn2	UTSW	19	4,801,686 (GRCm39)	missense	probably benign	0.22
R5159:Sptbn2	UTSW	19	4,787,885 (GRCm39)	missense	probably benign	0.12
R5202:Sptbn2	UTSW	19	4,774,212 (GRCm39)	missense	probably damaging	1.00
R5253:Sptbn2	UTSW	19	4,800,110 (GRCm39)	missense	probably benign	0.01
R5294:Sptbn2	UTSW	19	4,768,936 (GRCm39)	missense	possibly damaging	0.67
R5465:Sptbn2	UTSW	19	4,800,133 (GRCm39)	missense	probably benign	0.00
R5546:Sptbn2	UTSW	19	4,775,978 (GRCm39)	missense	probably damaging	1.00
R5593:Sptbn2	UTSW	19	4,798,975 (GRCm39)	missense	probably damaging	1.00
R5780:Sptbn2	UTSW	19	4,774,695 (GRCm39)	missense	probably damaging	1.00
R5835:Sptbn2	UTSW	19	4,788,247 (GRCm39)	missense	probably damaging	1.00
R6008:Sptbn2	UTSW	19	4,789,306 (GRCm39)	missense	possibly damaging	0.89
R6108:Sptbn2	UTSW	19	4,781,420 (GRCm39)	critical splice donor site	probably null
R6236:Sptbn2	UTSW	19	4,798,166 (GRCm39)	missense	probably benign	0.01
R6307:Sptbn2	UTSW	19	4,774,674 (GRCm39)	missense	probably damaging	1.00
R6383:Sptbn2	UTSW	19	4,782,524 (GRCm39)	missense	possibly damaging	0.89
R6397:Sptbn2	UTSW	19	4,792,446 (GRCm39)	missense	possibly damaging	0.91
R6453:Sptbn2	UTSW	19	4,794,208 (GRCm39)	missense	possibly damaging	0.67
R6561:Sptbn2	UTSW	19	4,797,954 (GRCm39)	missense	probably benign	0.39
R6564:Sptbn2	UTSW	19	4,782,052 (GRCm39)	missense	probably damaging	1.00
R6644:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R6703:Sptbn2	UTSW	19	4,799,843 (GRCm39)	missense	probably benign
R6703:Sptbn2	UTSW	19	4,799,842 (GRCm39)	missense	probably benign
R6753:Sptbn2	UTSW	19	4,797,813 (GRCm39)	missense	probably benign	0.01
R7007:Sptbn2	UTSW	19	4,794,173 (GRCm39)	missense	possibly damaging	0.82
R7131:Sptbn2	UTSW	19	4,799,488 (GRCm39)	missense	probably null
R7219:Sptbn2	UTSW	19	4,774,201 (GRCm39)	missense	probably damaging	1.00
R7285:Sptbn2	UTSW	19	4,787,471 (GRCm39)	missense	probably benign	0.00
R7308:Sptbn2	UTSW	19	4,801,602 (GRCm39)	missense	probably benign
R7469:Sptbn2	UTSW	19	4,795,146 (GRCm39)	missense	probably benign	0.00
R7502:Sptbn2	UTSW	19	4,798,110 (GRCm39)	missense	probably benign	0.02
R7623:Sptbn2	UTSW	19	4,776,196 (GRCm39)	missense	probably damaging	1.00
R7635:Sptbn2	UTSW	19	4,794,235 (GRCm39)	missense	probably damaging	1.00
R7733:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7738:Sptbn2	UTSW	19	4,774,153 (GRCm39)	missense	probably damaging	1.00
R7742:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7767:Sptbn2	UTSW	19	4,784,171 (GRCm39)	missense	possibly damaging	0.62
R7795:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7796:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7871:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7877:Sptbn2	UTSW	19	4,794,290 (GRCm39)	missense	possibly damaging	0.93
R7920:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7921:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7923:Sptbn2	UTSW	19	4,796,827 (GRCm39)	missense	probably benign	0.01
R8137:Sptbn2	UTSW	19	4,787,431 (GRCm39)	missense	possibly damaging	0.81
R8305:Sptbn2	UTSW	19	4,779,158 (GRCm39)	missense	possibly damaging	0.81
R8695:Sptbn2	UTSW	19	4,796,724 (GRCm39)	missense	possibly damaging	0.86
R8790:Sptbn2	UTSW	19	4,782,052 (GRCm39)	missense	probably damaging	1.00
R9125:Sptbn2	UTSW	19	4,784,241 (GRCm39)	missense	probably benign	0.04
R9483:Sptbn2	UTSW	19	4,789,974 (GRCm39)	missense	probably damaging	1.00
R9620:Sptbn2	UTSW	19	4,800,535 (GRCm39)	missense	probably damaging	0.99
R9631:Sptbn2	UTSW	19	4,788,218 (GRCm39)	missense	probably damaging	1.00
R9646:Sptbn2	UTSW	19	4,795,341 (GRCm39)	missense	probably damaging	1.00
R9694:Sptbn2	UTSW	19	4,800,535 (GRCm39)	missense	probably damaging	0.99
V7580:Sptbn2	UTSW	19	4,800,660 (GRCm39)	missense	probably damaging	1.00
Z1176:Sptbn2	UTSW	19	4,795,219 (GRCm39)	missense	probably benign	0.01
Z1176:Sptbn2	UTSW	19	4,788,233 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCGATGCTGTCCATAGATTTC -3'
(R):5'- TGTTCCAGAGCACTGACATG -3'

Sequencing Primer
(F):5'- GCTGTCCATAGATTTCTAAAACCTC -3'
(R):5'- CCAGAGCACTGACATGATTTGGTAC -3'

Posted On

2015-01-23