Incidental Mutation 'R6478:Tshz2'
ID516889
Institutional Source Beutler Lab
Gene Symbol Tshz2
Ensembl Gene ENSMUSG00000047907
Gene Nameteashirt zinc finger family member 2
SynonymsMtsh2, Sdccag33l, Zfp218, teashirt2, 2900073F20Rik, Tsh2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6478 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location169633013-170071816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 169884664 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 393 (L393F)
Ref Sequence ENSEMBL: ENSMUSP00000104787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109157] [ENSMUST00000109159] [ENSMUST00000123300] [ENSMUST00000140699] [ENSMUST00000185239]
Predicted Effect probably damaging
Transcript: ENSMUST00000109157
AA Change: L393F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104785
Gene: ENSMUSG00000047907
AA Change: L393F

DomainStartEndE-ValueType
coiled coil region 11 42 N/A INTRINSIC
ZnF_C2H2 216 240 1.62e0 SMART
ZnF_C2H2 276 300 7.15e-2 SMART
ZnF_C2H2 381 405 4.94e0 SMART
low complexity region 460 478 N/A INTRINSIC
low complexity region 598 613 N/A INTRINSIC
low complexity region 647 667 N/A INTRINSIC
low complexity region 710 722 N/A INTRINSIC
HOX 836 910 3.43e-4 SMART
ZnF_C2H2 922 944 5.34e-1 SMART
ZnF_C2H2 990 1013 3.58e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109159
AA Change: L393F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104787
Gene: ENSMUSG00000047907
AA Change: L393F

DomainStartEndE-ValueType
coiled coil region 11 42 N/A INTRINSIC
ZnF_C2H2 216 240 1.62e0 SMART
ZnF_C2H2 276 300 7.15e-2 SMART
ZnF_C2H2 381 405 4.94e0 SMART
low complexity region 460 478 N/A INTRINSIC
low complexity region 598 613 N/A INTRINSIC
low complexity region 647 667 N/A INTRINSIC
low complexity region 710 722 N/A INTRINSIC
HOX 836 910 3.43e-4 SMART
ZnF_C2H2 922 944 5.34e-1 SMART
ZnF_C2H2 990 1013 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123300
SMART Domains Protein: ENSMUSP00000118550
Gene: ENSMUSG00000047907

DomainStartEndE-ValueType
low complexity region 41 56 N/A INTRINSIC
low complexity region 90 110 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
HOX 279 353 1.7e-6 SMART
ZnF_C2H2 365 387 2.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140699
SMART Domains Protein: ENSMUSP00000120013
Gene: ENSMUSG00000047907

DomainStartEndE-ValueType
HOX 43 117 1.7e-6 SMART
ZnF_C2H2 129 151 2.3e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181446
Predicted Effect probably benign
Transcript: ENSMUST00000185239
SMART Domains Protein: ENSMUSP00000140884
Gene: ENSMUSG00000047907

DomainStartEndE-ValueType
low complexity region 129 144 N/A INTRINSIC
low complexity region 178 198 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
HOX 367 441 1.7e-6 SMART
ZnF_C2H2 453 475 2.3e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 95% (75/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the teashirt C2H2-type zinc-finger protein family of transcription factors. This gene encodes a protein with five C2H2-type zinc fingers, a homeobox DNA-binding domain and a coiled-coil domain. This nuclear protein is predicted to act as a transcriptional repressor. This gene is thought to play a role in the development and progression of breast and other types of cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a transposon induced allele die in utero; cultured blastocysts fail to hatch. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,332 V306A possibly damaging Het
9530053A07Rik C G 7: 28,155,373 P1808R probably damaging Het
Aatk T A 11: 120,010,991 S803C probably benign Het
Abcc9 C T 6: 142,679,308 A454T probably damaging Het
Abr T C 11: 76,452,332 E565G probably damaging Het
Adam33 C A 2: 131,051,346 R753L probably benign Het
Adgre1 A G 17: 57,401,955 T49A possibly damaging Het
AI314180 A T 4: 58,810,785 I1524N probably damaging Het
Ankra2 A T 13: 98,268,442 H153L probably damaging Het
Ankrd26 T G 6: 118,511,638 E1353D probably benign Het
Ankrd52 T G 10: 128,379,331 probably null Het
Arhgef10l T A 4: 140,542,757 T619S possibly damaging Het
Asgr1 T C 11: 70,056,894 V130A possibly damaging Het
Atg10 C A 13: 90,937,347 C161F probably damaging Het
Atm A T 9: 53,490,254 N1438K probably damaging Het
BC107364 T A 3: 96,436,006 probably null Het
Bcar3 G T 3: 122,426,576 A41S probably benign Het
Btbd6 A G 12: 112,977,312 probably benign Het
Cchcr1 A G 17: 35,524,703 T318A possibly damaging Het
Celsr1 A T 15: 85,925,518 I2221N probably damaging Het
Cept1 C T 3: 106,533,445 W48* probably null Het
Cfap161 T A 7: 83,793,276 I85L probably benign Het
Clasp1 A T 1: 118,512,180 R640* probably null Het
Col5a1 T A 2: 27,952,436 I441N unknown Het
Col9a1 C A 1: 24,185,405 L223I unknown Het
Dnah2 T C 11: 69,516,010 D223G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpy19l1 A T 9: 24,450,696 M129K possibly damaging Het
Fcrl1 C A 3: 87,389,639 H318Q probably benign Het
Fer1l5 A G 1: 36,402,531 N609S probably damaging Het
Fkbp4 C T 6: 128,433,231 E256K probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Glrx G A 13: 75,847,299 probably null Het
Gm6614 A T 6: 141,993,642 N208K possibly damaging Het
Gm7356 A T 17: 14,001,464 M101K probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Hectd3 A C 4: 116,999,586 K443N probably damaging Het
Hmcn1 T A 1: 150,664,784 R2925W probably damaging Het
Hspa1a G T 17: 34,970,306 N540K probably damaging Het
Ints6 A T 14: 62,700,786 M649K probably benign Het
Katnb1 T C 8: 95,095,456 V270A possibly damaging Het
Kctd3 A G 1: 188,972,364 S737P probably benign Het
Klra10 T C 6: 130,272,544 probably null Het
Lmtk3 A G 7: 45,798,589 D1353G unknown Het
Lrrk1 A G 7: 66,262,733 V1693A probably damaging Het
Mpnd A T 17: 56,009,575 I85F probably damaging Het
Myo3b A G 2: 70,348,960 T1173A probably benign Het
Myof G A 19: 37,903,831 P1158L probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Ncor2 A G 5: 125,110,005 probably benign Het
Npepps C T 11: 97,258,273 probably null Het
Olfr1247 T G 2: 89,609,446 I219L probably damaging Het
Opn5 T A 17: 42,580,749 I266F probably benign Het
P2rx4 A G 5: 122,707,700 D16G probably damaging Het
Padi2 G T 4: 140,917,637 V61L probably benign Het
Pkd1l1 G A 11: 8,863,911 T1480I probably benign Het
Plcb1 T C 2: 135,335,451 S568P probably damaging Het
Rassf10 A G 7: 112,955,707 E505G probably damaging Het
Rcan2 A G 17: 43,836,334 E21G probably benign Het
Rhob G T 12: 8,499,585 C16* probably null Het
Ryr3 T C 2: 112,660,068 N3807S probably damaging Het
Sass6 T A 3: 116,621,397 N519K probably benign Het
Smad9 A T 3: 54,782,443 D28V probably damaging Het
Tepp A T 8: 95,321,266 probably null Het
Tex14 G T 11: 87,514,373 G704C probably benign Het
Tmc3 A G 7: 83,622,316 N892S probably benign Het
Tnfaip2 T A 12: 111,445,663 L166Q probably damaging Het
Triml2 A G 8: 43,185,128 probably null Het
Trio A G 15: 27,856,107 V666A probably benign Het
Ttn T G 2: 76,841,771 probably benign Het
Tubb5 A G 17: 35,835,842 Y159H probably damaging Het
Umodl1 A G 17: 30,959,155 Y35C probably damaging Het
Utp4 T C 8: 106,904,446 probably null Het
Vmn1r60 A T 7: 5,544,865 C79S probably damaging Het
Wnt5b T C 6: 119,433,790 T230A probably damaging Het
Zfp618 A T 4: 63,132,706 I575F probably damaging Het
Zmym6 G T 4: 127,123,383 V894L possibly damaging Het
Zpbp T C 11: 11,462,318 probably benign Het
Other mutations in Tshz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01901:Tshz2 APN 2 169885536 missense possibly damaging 0.87
IGL01973:Tshz2 APN 2 169884683 missense probably damaging 1.00
IGL02209:Tshz2 APN 2 169884764 missense probably damaging 1.00
PIT4504001:Tshz2 UTSW 2 169886051 missense probably damaging 1.00
R0084:Tshz2 UTSW 2 169884366 missense probably damaging 1.00
R1757:Tshz2 UTSW 2 169883923 missense probably benign
R1908:Tshz2 UTSW 2 169885545 missense possibly damaging 0.95
R2082:Tshz2 UTSW 2 169886215 missense probably damaging 1.00
R2256:Tshz2 UTSW 2 169886477 missense probably damaging 1.00
R2259:Tshz2 UTSW 2 169886406 missense probably benign 0.43
R2260:Tshz2 UTSW 2 169886406 missense probably benign 0.43
R2444:Tshz2 UTSW 2 169884806 missense probably benign
R3085:Tshz2 UTSW 2 169883951 missense probably benign 0.10
R3904:Tshz2 UTSW 2 169884387 missense probably damaging 1.00
R4021:Tshz2 UTSW 2 169885862 missense probably damaging 1.00
R4061:Tshz2 UTSW 2 169962325 intron probably benign
R4064:Tshz2 UTSW 2 169962325 intron probably benign
R4113:Tshz2 UTSW 2 169885530 missense probably benign 0.14
R4321:Tshz2 UTSW 2 169885545 missense possibly damaging 0.95
R4355:Tshz2 UTSW 2 169884938 missense possibly damaging 0.79
R4458:Tshz2 UTSW 2 169885088 missense probably benign 0.29
R4779:Tshz2 UTSW 2 169962681 intron probably benign
R4841:Tshz2 UTSW 2 169886247 missense probably damaging 0.98
R4945:Tshz2 UTSW 2 169883874 missense probably damaging 1.00
R5073:Tshz2 UTSW 2 169962573 intron probably benign
R5110:Tshz2 UTSW 2 169884197 missense possibly damaging 0.48
R5404:Tshz2 UTSW 2 169884320 missense probably benign 0.02
R5425:Tshz2 UTSW 2 169884024 missense probably damaging 1.00
R5473:Tshz2 UTSW 2 169883798 missense probably benign
R5587:Tshz2 UTSW 2 169884342 missense probably damaging 1.00
R5832:Tshz2 UTSW 2 169884045 missense possibly damaging 0.56
R6351:Tshz2 UTSW 2 169884968 missense probably benign 0.16
R6375:Tshz2 UTSW 2 169886019 missense probably damaging 1.00
R6675:Tshz2 UTSW 2 169886045 missense probably damaging 1.00
R6742:Tshz2 UTSW 2 169883757 missense probably damaging 1.00
R7398:Tshz2 UTSW 2 169884174 missense probably damaging 1.00
R7722:Tshz2 UTSW 2 169885272 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGGGTCCCTTGCAGATTC -3'
(R):5'- AGAGAGTCTTCGTAGTCCTCG -3'

Sequencing Primer
(F):5'- GCAGATTCCTTTTCTTCCCAGAAG -3'
(R):5'- TAGAGGCTGTGCACTCCGAG -3'
Posted On2018-05-21