Incidental Mutation 'PIT4504001:Tshz2'
ID555992
Institutional Source Beutler Lab
Gene Symbol Tshz2
Ensembl Gene ENSMUSG00000047907
Gene Nameteashirt zinc finger family member 2
SynonymsMtsh2, Sdccag33l, Zfp218, teashirt2, 2900073F20Rik, Tsh2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4504001 (G1)
Quality Score215.009
Status Not validated
Chromosome2
Chromosomal Location169633013-170071816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 169886051 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 856 (F856L)
Ref Sequence ENSEMBL: ENSMUSP00000104787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109157] [ENSMUST00000109159] [ENSMUST00000123300] [ENSMUST00000140699] [ENSMUST00000185239]
Predicted Effect probably damaging
Transcript: ENSMUST00000109157
AA Change: F856L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104785
Gene: ENSMUSG00000047907
AA Change: F856L

DomainStartEndE-ValueType
coiled coil region 11 42 N/A INTRINSIC
ZnF_C2H2 216 240 1.62e0 SMART
ZnF_C2H2 276 300 7.15e-2 SMART
ZnF_C2H2 381 405 4.94e0 SMART
low complexity region 460 478 N/A INTRINSIC
low complexity region 598 613 N/A INTRINSIC
low complexity region 647 667 N/A INTRINSIC
low complexity region 710 722 N/A INTRINSIC
HOX 836 910 3.43e-4 SMART
ZnF_C2H2 922 944 5.34e-1 SMART
ZnF_C2H2 990 1013 3.58e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109159
AA Change: F856L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104787
Gene: ENSMUSG00000047907
AA Change: F856L

DomainStartEndE-ValueType
coiled coil region 11 42 N/A INTRINSIC
ZnF_C2H2 216 240 1.62e0 SMART
ZnF_C2H2 276 300 7.15e-2 SMART
ZnF_C2H2 381 405 4.94e0 SMART
low complexity region 460 478 N/A INTRINSIC
low complexity region 598 613 N/A INTRINSIC
low complexity region 647 667 N/A INTRINSIC
low complexity region 710 722 N/A INTRINSIC
HOX 836 910 3.43e-4 SMART
ZnF_C2H2 922 944 5.34e-1 SMART
ZnF_C2H2 990 1013 3.58e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123300
AA Change: F387L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118550
Gene: ENSMUSG00000047907
AA Change: F387L

DomainStartEndE-ValueType
low complexity region 41 56 N/A INTRINSIC
low complexity region 90 110 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
HOX 279 353 1.7e-6 SMART
ZnF_C2H2 365 387 2.3e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000140699
AA Change: F73L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120013
Gene: ENSMUSG00000047907
AA Change: F73L

DomainStartEndE-ValueType
HOX 43 117 1.7e-6 SMART
ZnF_C2H2 129 151 2.3e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185239
AA Change: F387L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140884
Gene: ENSMUSG00000047907
AA Change: F387L

DomainStartEndE-ValueType
low complexity region 129 144 N/A INTRINSIC
low complexity region 178 198 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
HOX 367 441 1.7e-6 SMART
ZnF_C2H2 453 475 2.3e-3 SMART
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the teashirt C2H2-type zinc-finger protein family of transcription factors. This gene encodes a protein with five C2H2-type zinc fingers, a homeobox DNA-binding domain and a coiled-coil domain. This nuclear protein is predicted to act as a transcriptional repressor. This gene is thought to play a role in the development and progression of breast and other types of cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a transposon induced allele die in utero; cultured blastocysts fail to hatch. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,717,192 C970* probably null Het
Adgrv1 G A 13: 81,559,352 P1312S probably damaging Het
Als2cr12 T A 1: 58,659,099 I348F probably benign Het
Arid5a T C 1: 36,317,625 I116T probably damaging Het
Bank1 C A 3: 136,100,419 D485Y probably damaging Het
Cbln3 C T 14: 55,883,499 V122M probably damaging Het
Cox10 C T 11: 63,964,216 C413Y possibly damaging Het
Ctsll3 T A 13: 60,801,009 D44V probably benign Het
Cuzd1 A T 7: 131,309,800 N483K possibly damaging Het
Dcaf4 G A 12: 83,534,011 probably null Het
Ddx60 A G 8: 61,958,113 T470A probably benign Het
Dennd1b T C 1: 139,040,004 V44A probably benign Het
Dusp16 C A 6: 134,739,883 V154F possibly damaging Het
Ect2 G A 3: 27,126,948 R586* probably null Het
Ermard T A 17: 15,058,822 C460* probably null Het
Fat2 C T 11: 55,256,110 G4020D possibly damaging Het
Galnt16 G T 12: 80,592,417 E402* probably null Het
Gm5414 T G 15: 101,625,823 D282A probably damaging Het
Gm6741 C T 17: 91,236,916 Q36* probably null Het
Gm7356 A T 17: 14,001,458 L103Q probably damaging Het
Hcn1 A G 13: 117,975,875 T792A possibly damaging Het
Hemgn T C 4: 46,395,863 N458D probably benign Het
Hesx1 C A 14: 27,001,881 D140E probably benign Het
Hfe2 A T 3: 96,528,497 D357V probably damaging Het
Hmgcr A G 13: 96,663,097 I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 T249A possibly damaging Het
Il33 A T 19: 29,952,739 H78L probably benign Het
Inpp4b A T 8: 82,041,935 D691V probably damaging Het
Itpr2 T A 6: 146,229,871 N1945I probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrp2 T C 2: 69,475,403 D2938G probably damaging Het
Lrrc8c A T 5: 105,608,537 Y726F probably benign Het
Magi3 G T 3: 104,015,526 Q1292K probably benign Het
Mllt3 A C 4: 87,774,087 F546L probably damaging Het
Mrpl14 A G 17: 45,698,221 K82R probably benign Het
Noxred1 A G 12: 87,224,879 V172A possibly damaging Het
Obscn A T 11: 59,133,122 I574N probably damaging Het
Olfr133 A G 17: 38,149,169 T194A probably benign Het
Olfr175-ps1 T A 16: 58,824,308 T134S probably benign Het
Osbpl11 T A 16: 33,234,494 V649D probably benign Het
Pdlim2 G T 14: 70,166,130 P278T probably benign Het
Pm20d2 A C 4: 33,183,152 L223V probably damaging Het
Pmpcb G T 5: 21,743,390 R223L probably damaging Het
Pole2 A T 12: 69,209,985 Y255* probably null Het
Rims1 T A 1: 22,397,460 I317L Het
Scnn1g C A 7: 121,742,331 H239N probably benign Het
Spag17 A G 3: 100,103,110 probably null Het
Tenm3 A T 8: 48,293,657 F1038I probably damaging Het
Ubtf A G 11: 102,306,682 S715P unknown Het
Usp13 A C 3: 32,905,430 S557R probably damaging Het
Usp19 T A 9: 108,492,970 S43T probably benign Het
Vmn2r7 A T 3: 64,715,976 Y308N probably benign Het
Zfp455 A G 13: 67,198,621 D32G probably damaging Het
Zfp512 T A 5: 31,476,881 probably null Het
Zfr A G 15: 12,166,158 E838G possibly damaging Het
Other mutations in Tshz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01901:Tshz2 APN 2 169885536 missense possibly damaging 0.87
IGL01973:Tshz2 APN 2 169884683 missense probably damaging 1.00
IGL02209:Tshz2 APN 2 169884764 missense probably damaging 1.00
R0084:Tshz2 UTSW 2 169884366 missense probably damaging 1.00
R1757:Tshz2 UTSW 2 169883923 missense probably benign
R1908:Tshz2 UTSW 2 169885545 missense possibly damaging 0.95
R2082:Tshz2 UTSW 2 169886215 missense probably damaging 1.00
R2256:Tshz2 UTSW 2 169886477 missense probably damaging 1.00
R2259:Tshz2 UTSW 2 169886406 missense probably benign 0.43
R2260:Tshz2 UTSW 2 169886406 missense probably benign 0.43
R2444:Tshz2 UTSW 2 169884806 missense probably benign
R3085:Tshz2 UTSW 2 169883951 missense probably benign 0.10
R3904:Tshz2 UTSW 2 169884387 missense probably damaging 1.00
R4021:Tshz2 UTSW 2 169885862 missense probably damaging 1.00
R4061:Tshz2 UTSW 2 169962325 intron probably benign
R4064:Tshz2 UTSW 2 169962325 intron probably benign
R4113:Tshz2 UTSW 2 169885530 missense probably benign 0.14
R4321:Tshz2 UTSW 2 169885545 missense possibly damaging 0.95
R4355:Tshz2 UTSW 2 169884938 missense possibly damaging 0.79
R4458:Tshz2 UTSW 2 169885088 missense probably benign 0.29
R4779:Tshz2 UTSW 2 169962681 intron probably benign
R4841:Tshz2 UTSW 2 169886247 missense probably damaging 0.98
R4945:Tshz2 UTSW 2 169883874 missense probably damaging 1.00
R5073:Tshz2 UTSW 2 169962573 intron probably benign
R5110:Tshz2 UTSW 2 169884197 missense possibly damaging 0.48
R5404:Tshz2 UTSW 2 169884320 missense probably benign 0.02
R5425:Tshz2 UTSW 2 169884024 missense probably damaging 1.00
R5473:Tshz2 UTSW 2 169883798 missense probably benign
R5587:Tshz2 UTSW 2 169884342 missense probably damaging 1.00
R5832:Tshz2 UTSW 2 169884045 missense possibly damaging 0.56
R6351:Tshz2 UTSW 2 169884968 missense probably benign 0.16
R6375:Tshz2 UTSW 2 169886019 missense probably damaging 1.00
R6478:Tshz2 UTSW 2 169884664 missense probably damaging 1.00
R6675:Tshz2 UTSW 2 169886045 missense probably damaging 1.00
R6742:Tshz2 UTSW 2 169883757 missense probably damaging 1.00
R7398:Tshz2 UTSW 2 169884174 missense probably damaging 1.00
R7722:Tshz2 UTSW 2 169885272 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGACATTGCTGATATGGTCAAG -3'
(R):5'- AAGATGGGGTGCCCTTTGTC -3'

Sequencing Primer
(F):5'- ACATTGCTGATATGGTCAAGGTCCTC -3'
(R):5'- GTCCATGTTTTTCAGGAACTTTGTC -3'
Posted On2019-06-07