Incidental Mutation 'R4355:Tshz2'
ID 327472
Institutional Source Beutler Lab
Gene Symbol Tshz2
Ensembl Gene ENSMUSG00000047907
Gene Name teashirt zinc finger family member 2
Synonyms Mtsh2, Sdccag33l, Zfp218, teashirt2, 2900073F20Rik, Tsh2
MMRRC Submission 041108-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4355 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 169633013-170071816 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 169884938 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 16 (E16K)
Ref Sequence ENSEMBL: ENSMUSP00000140884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109157] [ENSMUST00000109159] [ENSMUST00000123300] [ENSMUST00000140699] [ENSMUST00000185239]
AlphaFold Q68FE9
Predicted Effect possibly damaging
Transcript: ENSMUST00000109157
AA Change: E485K

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104785
Gene: ENSMUSG00000047907
AA Change: E485K

DomainStartEndE-ValueType
coiled coil region 11 42 N/A INTRINSIC
ZnF_C2H2 216 240 1.62e0 SMART
ZnF_C2H2 276 300 7.15e-2 SMART
ZnF_C2H2 381 405 4.94e0 SMART
low complexity region 460 478 N/A INTRINSIC
low complexity region 598 613 N/A INTRINSIC
low complexity region 647 667 N/A INTRINSIC
low complexity region 710 722 N/A INTRINSIC
HOX 836 910 3.43e-4 SMART
ZnF_C2H2 922 944 5.34e-1 SMART
ZnF_C2H2 990 1013 3.58e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109159
AA Change: E485K

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104787
Gene: ENSMUSG00000047907
AA Change: E485K

DomainStartEndE-ValueType
coiled coil region 11 42 N/A INTRINSIC
ZnF_C2H2 216 240 1.62e0 SMART
ZnF_C2H2 276 300 7.15e-2 SMART
ZnF_C2H2 381 405 4.94e0 SMART
low complexity region 460 478 N/A INTRINSIC
low complexity region 598 613 N/A INTRINSIC
low complexity region 647 667 N/A INTRINSIC
low complexity region 710 722 N/A INTRINSIC
HOX 836 910 3.43e-4 SMART
ZnF_C2H2 922 944 5.34e-1 SMART
ZnF_C2H2 990 1013 3.58e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000123300
AA Change: E16K

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118550
Gene: ENSMUSG00000047907
AA Change: E16K

DomainStartEndE-ValueType
low complexity region 41 56 N/A INTRINSIC
low complexity region 90 110 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
HOX 279 353 1.7e-6 SMART
ZnF_C2H2 365 387 2.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140699
SMART Domains Protein: ENSMUSP00000120013
Gene: ENSMUSG00000047907

DomainStartEndE-ValueType
HOX 43 117 1.7e-6 SMART
ZnF_C2H2 129 151 2.3e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181446
Predicted Effect possibly damaging
Transcript: ENSMUST00000185239
AA Change: E16K

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140884
Gene: ENSMUSG00000047907
AA Change: E16K

DomainStartEndE-ValueType
low complexity region 129 144 N/A INTRINSIC
low complexity region 178 198 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
HOX 367 441 1.7e-6 SMART
ZnF_C2H2 453 475 2.3e-3 SMART
Meta Mutation Damage Score 0.0625 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the teashirt C2H2-type zinc-finger protein family of transcription factors. This gene encodes a protein with five C2H2-type zinc fingers, a homeobox DNA-binding domain and a coiled-coil domain. This nuclear protein is predicted to act as a transcriptional repressor. This gene is thought to play a role in the development and progression of breast and other types of cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a transposon induced allele die in utero; cultured blastocysts fail to hatch. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T G 8: 43,570,185 Q89H probably benign Het
Adgrb1 T C 15: 74,543,662 F697S probably damaging Het
Adgrl2 A T 3: 148,839,152 V769E probably damaging Het
Aldh7a1 A T 18: 56,548,494 F173L probably null Het
Arntl A G 7: 113,303,406 I421V possibly damaging Het
Bcl3 G T 7: 19,811,580 C208* probably null Het
Casz1 T C 4: 148,952,335 S1685P unknown Het
Cep250 A G 2: 155,991,525 E1789G probably damaging Het
Cep76 A T 18: 67,626,640 D334E probably benign Het
Clca3b A T 3: 144,825,458 probably null Het
Col9a3 A G 2: 180,606,478 S208G probably benign Het
Ddx47 T C 6: 135,021,505 V388A probably benign Het
Dync1h1 C T 12: 110,632,899 A1896V possibly damaging Het
Eif2ak2 T A 17: 78,858,534 R411S probably benign Het
F7 A G 8: 13,034,774 T267A probably benign Het
Fras1 C A 5: 96,700,242 D1770E probably benign Het
G2e3 T A 12: 51,365,337 Y387N probably benign Het
Hspg2 C T 4: 137,529,418 L1491F probably damaging Het
Ighv3-4 T C 12: 114,253,640 I110M probably benign Het
Itgb5 T A 16: 33,844,997 C28S probably damaging Het
Kbtbd11 C A 8: 15,028,578 N392K probably damaging Het
Kcnmb4 A G 10: 116,473,284 S80P possibly damaging Het
Kif21a C T 15: 90,970,833 C721Y probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klrc3 T C 6: 129,639,162 M189V probably benign Het
Macf1 T A 4: 123,475,091 E394V possibly damaging Het
Mrgprb4 C T 7: 48,198,701 G160R possibly damaging Het
Myb A G 10: 21,152,617 S116P probably damaging Het
Nf2 G A 11: 4,780,613 Q513* probably null Het
Nmnat3 C T 9: 98,410,152 T150M possibly damaging Het
Olfr361 C A 2: 37,084,930 V273F probably benign Het
Olfr743 T C 14: 50,533,759 C116R possibly damaging Het
Patj T G 4: 98,650,454 C210W possibly damaging Het
Pde3b A G 7: 114,416,287 H246R probably benign Het
Pnp2 A G 14: 50,959,625 H56R probably benign Het
Prkg1 A G 19: 30,569,229 probably benign Het
Rhbdf1 C T 11: 32,216,236 S8N probably damaging Het
Rimbp3 A G 16: 17,209,692 K327E possibly damaging Het
Rnf219 A G 14: 104,479,257 V560A probably benign Het
Rsph6a T A 7: 19,067,078 probably null Het
Ryr2 T C 13: 11,649,812 N3535S probably benign Het
Ssfa2 A G 2: 79,641,998 N132S probably benign Het
Ston1 T G 17: 88,637,008 V614G probably damaging Het
Svep1 T A 4: 58,138,695 T466S possibly damaging Het
Tas2r109 A T 6: 132,980,181 I262N probably benign Het
Tmtc1 T C 6: 148,355,098 probably benign Het
Ufsp2 T A 8: 45,985,465 S193R possibly damaging Het
Ugt2b5 C A 5: 87,139,763 E182* probably null Het
Usp43 A G 11: 67,891,464 V376A probably benign Het
Utp15 A T 13: 98,259,247 F76I possibly damaging Het
Wdr62 A C 7: 30,242,248 L1141R probably damaging Het
Zfp418 T A 7: 7,172,162 M18K probably benign Het
Other mutations in Tshz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01901:Tshz2 APN 2 169885536 missense possibly damaging 0.87
IGL01973:Tshz2 APN 2 169884683 missense probably damaging 1.00
IGL02209:Tshz2 APN 2 169884764 missense probably damaging 1.00
BB009:Tshz2 UTSW 2 169886331 missense possibly damaging 0.95
BB019:Tshz2 UTSW 2 169886331 missense possibly damaging 0.95
PIT4504001:Tshz2 UTSW 2 169886051 missense probably damaging 1.00
R0084:Tshz2 UTSW 2 169884366 missense probably damaging 1.00
R1757:Tshz2 UTSW 2 169883923 missense probably benign
R1908:Tshz2 UTSW 2 169885545 missense possibly damaging 0.95
R2082:Tshz2 UTSW 2 169886215 missense probably damaging 1.00
R2256:Tshz2 UTSW 2 169886477 missense probably damaging 1.00
R2259:Tshz2 UTSW 2 169886406 missense probably benign 0.43
R2260:Tshz2 UTSW 2 169886406 missense probably benign 0.43
R2444:Tshz2 UTSW 2 169884806 missense probably benign
R3085:Tshz2 UTSW 2 169883951 missense probably benign 0.10
R3904:Tshz2 UTSW 2 169884387 missense probably damaging 1.00
R4021:Tshz2 UTSW 2 169885862 missense probably damaging 1.00
R4061:Tshz2 UTSW 2 169962325 intron probably benign
R4064:Tshz2 UTSW 2 169962325 intron probably benign
R4113:Tshz2 UTSW 2 169885530 missense probably benign 0.14
R4321:Tshz2 UTSW 2 169885545 missense possibly damaging 0.95
R4458:Tshz2 UTSW 2 169885088 missense probably benign 0.29
R4779:Tshz2 UTSW 2 169962681 intron probably benign
R4841:Tshz2 UTSW 2 169886247 missense probably damaging 0.98
R4945:Tshz2 UTSW 2 169883874 missense probably damaging 1.00
R5073:Tshz2 UTSW 2 169962573 intron probably benign
R5110:Tshz2 UTSW 2 169884197 missense possibly damaging 0.48
R5404:Tshz2 UTSW 2 169884320 missense probably benign 0.02
R5425:Tshz2 UTSW 2 169884024 missense probably damaging 1.00
R5473:Tshz2 UTSW 2 169883798 missense probably benign
R5587:Tshz2 UTSW 2 169884342 missense probably damaging 1.00
R5832:Tshz2 UTSW 2 169884045 missense possibly damaging 0.56
R6351:Tshz2 UTSW 2 169884968 missense probably benign 0.16
R6375:Tshz2 UTSW 2 169886019 missense probably damaging 1.00
R6478:Tshz2 UTSW 2 169884664 missense probably damaging 1.00
R6675:Tshz2 UTSW 2 169886045 missense probably damaging 1.00
R6742:Tshz2 UTSW 2 169883757 missense probably damaging 1.00
R7398:Tshz2 UTSW 2 169884174 missense probably damaging 1.00
R7722:Tshz2 UTSW 2 169885272 missense probably benign
R7932:Tshz2 UTSW 2 169886331 missense possibly damaging 0.95
R8166:Tshz2 UTSW 2 169883655 missense probably benign 0.07
R8721:Tshz2 UTSW 2 169885358 missense probably benign 0.00
R8855:Tshz2 UTSW 2 169886505 missense probably damaging 1.00
R8962:Tshz2 UTSW 2 169884604 missense probably damaging 1.00
R9163:Tshz2 UTSW 2 169884642 missense probably damaging 1.00
R9376:Tshz2 UTSW 2 169884093 missense probably benign 0.06
R9501:Tshz2 UTSW 2 169883839 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TAGCTCTGCCTCCAAGAAAGG -3'
(R):5'- ATACTTGGGTATGCGCTCCAG -3'

Sequencing Primer
(F):5'- CCCCCTAGCTGTGGAGAAAATG -3'
(R):5'- TATGCGCTCCAGCTGGG -3'
Posted On 2015-07-07