Incidental Mutation 'R3029:E2f5'
ID 265899
Institutional Source Beutler Lab
Gene Symbol E2f5
Ensembl Gene ENSMUSG00000027552
Gene Name E2F transcription factor 5
Synonyms E2F-5
MMRRC Submission 040545-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.677) question?
Stock # R3029 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 14643701-14671369 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 14668725 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 206 (I206V)
Ref Sequence ENSEMBL: ENSMUSP00000127877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029069] [ENSMUST00000108365] [ENSMUST00000165922] [ENSMUST00000185384] [ENSMUST00000185423] [ENSMUST00000186870]
AlphaFold Q61502
Predicted Effect probably benign
Transcript: ENSMUST00000029069
AA Change: I205V

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029069
Gene: ENSMUSG00000027552
AA Change: I205V

DomainStartEndE-ValueType
low complexity region 6 33 N/A INTRINSIC
Pfam:E2F_TDP 40 106 3.3e-28 PFAM
coiled coil region 111 146 N/A INTRINSIC
low complexity region 223 256 N/A INTRINSIC
low complexity region 283 293 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108365
SMART Domains Protein: ENSMUSP00000104002
Gene: ENSMUSG00000078784

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165922
AA Change: I206V

PolyPhen 2 Score 0.368 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127877
Gene: ENSMUSG00000027552
AA Change: I206V

DomainStartEndE-ValueType
low complexity region 6 33 N/A INTRINSIC
E2F_TDP 40 106 8.76e-31 SMART
Pfam:E2F_CC-MB 123 221 6.9e-35 PFAM
low complexity region 224 257 N/A INTRINSIC
low complexity region 284 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185384
Predicted Effect probably benign
Transcript: ENSMUST00000185423
Predicted Effect probably benign
Transcript: ENSMUST00000186870
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionarily conserved domains that are present in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein is differentially phosphorylated and is expressed in a wide variety of human tissues. It has higher identity to E2F4 than to other family members. Both this protein and E2F4 interact with tumor suppressor proteins p130 and p107, but not with pRB. Alternative splicing results in multiple variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop non-obstructive hydrocephalus, ruffled coats, ataxic gait, and dehydration after weaning and die prematurely at an average age of 6 weeks. They exhibit dilated ventricles and cerebral cortex atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A G 1: 85,645,966 (GRCm39) I213T probably benign Het
Atp8a2 CGT CGTGT 14: 59,928,914 (GRCm39) probably null Het
Cdh15 G A 8: 123,588,763 (GRCm39) R279Q probably damaging Het
Cdk6 G A 5: 3,440,817 (GRCm39) probably null Het
Cryab T A 9: 50,667,638 (GRCm39) I124N probably damaging Het
Eya4 T C 10: 22,999,776 (GRCm39) T396A probably benign Het
Fat2 T C 11: 55,175,535 (GRCm39) Y1726C probably damaging Het
Gad1 G A 2: 70,425,034 (GRCm39) V443I probably benign Het
H2-M11 C T 17: 36,859,042 (GRCm39) T194I possibly damaging Het
Ighv7-2 A G 12: 113,876,100 (GRCm39) F2L probably benign Het
Itgad T A 7: 127,777,543 (GRCm39) I141N possibly damaging Het
Kcnh1 C T 1: 192,188,368 (GRCm39) T970M probably benign Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Nlrp1a T A 11: 71,014,456 (GRCm39) T265S probably damaging Het
Nsun4 A G 4: 115,909,922 (GRCm39) S213P possibly damaging Het
Pkdrej C T 15: 85,701,205 (GRCm39) R1577Q probably benign Het
Proz A T 8: 13,111,042 (GRCm39) I5F probably benign Het
Rbm48 A T 5: 3,646,043 (GRCm39) F54I possibly damaging Het
Rgs20 T C 1: 5,140,276 (GRCm39) D42G probably benign Het
Rxfp2 A C 5: 149,966,595 (GRCm39) D111A probably benign Het
Sparcl1 T C 5: 104,241,092 (GRCm39) T111A possibly damaging Het
Vmn2r14 T A 5: 109,363,776 (GRCm39) L713F probably damaging Het
Other mutations in E2f5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:E2f5 APN 3 14,652,363 (GRCm39) splice site probably benign
IGL02388:E2f5 APN 3 14,653,340 (GRCm39) missense probably benign 0.00
IGL02415:E2f5 APN 3 14,668,957 (GRCm39) missense probably benign 0.00
R0401:E2f5 UTSW 3 14,644,085 (GRCm39) critical splice donor site probably null
R1977:E2f5 UTSW 3 14,652,416 (GRCm39) missense probably damaging 1.00
R2434:E2f5 UTSW 3 14,644,074 (GRCm39) missense probably damaging 1.00
R4405:E2f5 UTSW 3 14,668,823 (GRCm39) missense probably benign 0.09
R4407:E2f5 UTSW 3 14,668,823 (GRCm39) missense probably benign 0.09
R4780:E2f5 UTSW 3 14,652,379 (GRCm39) missense probably benign 0.01
R6627:E2f5 UTSW 3 14,668,917 (GRCm39) missense probably benign 0.06
R9557:E2f5 UTSW 3 14,653,311 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TAGGCACAAGTTAGGATTCCTG -3'
(R):5'- TTTCGGAAACATGCTGCTCAGG -3'

Sequencing Primer
(F):5'- GGCACAAGTTAGGATTCCTGTTTTAC -3'
(R):5'- CTCAGGCAGGTTTTGAGCAGC -3'
Posted On 2015-02-05