Incidental Mutation 'R3411:Egfem1'
ID267699
Institutional Source Beutler Lab
Gene Symbol Egfem1
Ensembl Gene ENSMUSG00000063600
Gene NameEGF-like and EMI domain containing 1
Synonyms6130401L20Rik
MMRRC Submission 040629-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3411 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location29082023-29691209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29583021 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 202 (T202I)
Ref Sequence ENSEMBL: ENSMUSP00000112943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118531] [ENSMUST00000119598] [ENSMUST00000146943]
Predicted Effect possibly damaging
Transcript: ENSMUST00000118531
AA Change: T226I

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112907
Gene: ENSMUSG00000063600
AA Change: T226I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EMI 30 104 1.4e-15 PFAM
Blast:EGF_like 108 145 7e-10 BLAST
EGF 150 187 2.16e1 SMART
EGF_CA 188 228 2.66e-10 SMART
EGF 237 274 1.08e-1 SMART
EGF_like 275 313 9.19e-5 SMART
low complexity region 317 331 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
EGF 391 424 1.09e1 SMART
Blast:EGF_like 449 481 5e-10 BLAST
EGF 492 526 2.43e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119598
AA Change: T202I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112943
Gene: ENSMUSG00000063600
AA Change: T202I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EMI 31 102 1.1e-15 PFAM
Blast:EGF_like 108 145 6e-10 BLAST
EGF_CA 164 204 1.61e-9 SMART
EGF 208 244 6.4e-4 SMART
EGF_CA 245 285 1.81e-12 SMART
EGF 294 331 1.08e-1 SMART
EGF_like 332 370 9.19e-5 SMART
low complexity region 374 388 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
EGF 448 481 1.09e1 SMART
Blast:EGF_like 506 538 5e-10 BLAST
EGF 549 583 2.43e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126420
Predicted Effect unknown
Transcript: ENSMUST00000140288
AA Change: T73I
SMART Domains Protein: ENSMUSP00000117016
Gene: ENSMUSG00000063600
AA Change: T73I

DomainStartEndE-ValueType
EGF_like 5 35 4.32e-1 SMART
EGF_CA 36 76 2.66e-10 SMART
EGF 85 122 1.08e-1 SMART
low complexity region 124 138 N/A INTRINSIC
low complexity region 164 178 N/A INTRINSIC
EGF 198 231 1.09e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143483
SMART Domains Protein: ENSMUSP00000114146
Gene: ENSMUSG00000063600

DomainStartEndE-ValueType
EGF 22 59 2.16e1 SMART
EGF_CA 60 100 2.66e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146943
SMART Domains Protein: ENSMUSP00000118156
Gene: ENSMUSG00000063600

DomainStartEndE-ValueType
Pfam:EMI 17 91 1.8e-16 PFAM
Blast:EGF_like 95 132 2e-11 BLAST
EGF 137 174 2.16e1 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,419,822 V675D possibly damaging Het
Adamts16 T C 13: 70,753,226 T911A probably benign Het
Adgra1 T C 7: 139,847,703 F62S possibly damaging Het
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
Aff1 T A 5: 103,754,706 M1K probably null Het
AI429214 C T 8: 36,993,917 S73L probably benign Het
Apc C A 18: 34,269,259 probably benign Het
Apcs T C 1: 172,894,563 Y72C probably damaging Het
Arid4a T C 12: 71,061,525 probably benign Het
Armcx4 C A X: 134,691,025 Q561K probably benign Het
Atp5o C T 16: 91,928,906 R64H probably damaging Het
Bank1 G A 3: 136,247,773 probably benign Het
Ccdc150 A G 1: 54,356,773 D805G probably benign Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Dnah1 A T 14: 31,269,817 M3076K possibly damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Fam120b T A 17: 15,431,635 probably benign Het
Frem1 T C 4: 82,963,179 T1263A possibly damaging Het
Gm6802 C A 12: 19,490,620 noncoding transcript Het
Golga2 C A 2: 32,302,942 A424E probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Grik5 T C 7: 25,062,972 D198G probably benign Het
Hcrtr2 A G 9: 76,233,008 F333L probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Htr1b A C 9: 81,632,041 V171G probably benign Het
Kalrn G T 16: 34,212,272 D1117E probably benign Het
Kcp T C 6: 29,482,846 N1408S possibly damaging Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Klra17 T A 6: 129,874,846 N21I probably damaging Het
Lrrc8d A T 5: 105,826,706 noncoding transcript Het
Mast2 C G 4: 116,310,910 E881Q possibly damaging Het
Mcm6 T C 1: 128,351,585 T155A probably benign Het
Mslnl T C 17: 25,744,517 F326L probably benign Het
Nlrp4c A G 7: 6,092,570 K816E possibly damaging Het
Olfr1047 T C 2: 86,228,642 S110G probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr1510 T A 14: 52,410,361 R170S possibly damaging Het
Olfr494 A T 7: 108,368,344 I285F possibly damaging Het
Otoa A G 7: 121,122,043 Q427R probably damaging Het
Pcdhb6 A G 18: 37,335,892 E622G probably damaging Het
Pdzd8 A G 19: 59,345,413 Y59H probably damaging Het
Psmc3 A C 2: 91,055,918 D159A probably damaging Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Rpn2 C A 2: 157,290,652 A108E possibly damaging Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Slc16a4 G A 3: 107,300,872 E233K probably benign Het
Smu1 T C 4: 40,752,008 T183A probably benign Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Styxl1 T C 5: 135,765,764 Y83C probably damaging Het
Sypl2 C T 3: 108,216,729 V166I possibly damaging Het
Tal2 A G 4: 53,785,843 N8S probably damaging Het
Tenm4 T C 7: 96,852,530 Y1314H probably damaging Het
Ttn A C 2: 76,942,405 N2415K possibly damaging Het
Usp53 T C 3: 122,949,858 probably null Het
Vmn2r65 T C 7: 84,946,688 I263V probably benign Het
Other mutations in Egfem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Egfem1 APN 3 29657153 missense possibly damaging 0.54
IGL02111:Egfem1 APN 3 29650896 splice site probably null
IGL02325:Egfem1 APN 3 29151917 missense probably benign 0.01
IGL02450:Egfem1 APN 3 29657268 critical splice donor site probably null
IGL02543:Egfem1 APN 3 29668380 missense probably benign 0.01
IGL02835:Egfem1 UTSW 3 29657241 missense probably damaging 1.00
P0033:Egfem1 UTSW 3 29690191 missense probably damaging 1.00
R0010:Egfem1 UTSW 3 29582919 missense probably damaging 1.00
R0294:Egfem1 UTSW 3 29690121 missense probably damaging 1.00
R0379:Egfem1 UTSW 3 29668250 missense possibly damaging 0.92
R1479:Egfem1 UTSW 3 29657165 missense probably damaging 1.00
R1572:Egfem1 UTSW 3 29648271 missense probably benign 0.02
R1754:Egfem1 UTSW 3 29668333 missense possibly damaging 0.68
R2568:Egfem1 UTSW 3 29582931 missense probably damaging 1.00
R2679:Egfem1 UTSW 3 29670676 missense probably benign 0.01
R3801:Egfem1 UTSW 3 29151926 missense probably benign 0.14
R4049:Egfem1 UTSW 3 29686731 missense probably benign 0.01
R4851:Egfem1 UTSW 3 29151883 missense possibly damaging 0.92
R4917:Egfem1 UTSW 3 29151893 missense probably damaging 1.00
R4918:Egfem1 UTSW 3 29151893 missense probably damaging 1.00
R4969:Egfem1 UTSW 3 29582996 missense probably damaging 0.98
R4997:Egfem1 UTSW 3 29153590 missense probably benign 0.00
R5148:Egfem1 UTSW 3 29457823 intron probably benign
R5194:Egfem1 UTSW 3 29357196 critical splice donor site probably null
R5284:Egfem1 UTSW 3 29650787 missense possibly damaging 0.53
R5354:Egfem1 UTSW 3 29082212 critical splice donor site probably null
R5627:Egfem1 UTSW 3 29668399 nonsense probably null
R5677:Egfem1 UTSW 3 29690174 missense probably damaging 0.99
R5928:Egfem1 UTSW 3 29582928 missense possibly damaging 0.92
R5982:Egfem1 UTSW 3 29657270 splice site probably null
R6419:Egfem1 UTSW 3 29657249 missense probably damaging 1.00
R6475:Egfem1 UTSW 3 29657163 missense probably damaging 1.00
R6586:Egfem1 UTSW 3 29662411 nonsense probably null
R7046:Egfem1 UTSW 3 29082215 splice site probably null
R7079:Egfem1 UTSW 3 29153582 missense probably benign 0.00
R7308:Egfem1 UTSW 3 29151866 missense probably benign 0.09
R7362:Egfem1 UTSW 3 29151920 missense probably benign 0.01
R7684:Egfem1 UTSW 3 29690185 missense probably damaging 0.97
R7697:Egfem1 UTSW 3 29690197 critical splice donor site probably null
R7814:Egfem1 UTSW 3 29686791 missense probably damaging 1.00
X0028:Egfem1 UTSW 3 29657146 missense probably damaging 1.00
Z1177:Egfem1 UTSW 3 29148453 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CTCTGAAGTTGACATTGGAATGAC -3'
(R):5'- ATGGCTTAAAGTTCCCCATCC -3'

Sequencing Primer
(F):5'- GGAATGACATTGTAATCCTGGCC -3'
(R):5'- GAAATCTTTCTCCTCAGCC -3'
Posted On2015-02-18