Incidental Mutation 'R3411:Hcrtr2'
ID267722
Institutional Source Beutler Lab
Gene Symbol Hcrtr2
Ensembl Gene ENSMUSG00000032360
Gene Namehypocretin (orexin) receptor 2
SynonymsmOXR2, OX2r, mOX2aR, mOX2bR
MMRRC Submission 040629-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R3411 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location76225880-76323856 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76233008 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 333 (F333L)
Ref Sequence ENSEMBL: ENSMUSP00000139377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063140] [ENSMUST00000184757]
Predicted Effect probably benign
Transcript: ENSMUST00000063140
AA Change: F333L

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000058230
Gene: ENSMUSG00000032360
AA Change: F333L

DomainStartEndE-ValueType
Pfam:7tm_1 71 364 2.2e-59 PFAM
Pfam:Orexin_rec2 386 443 1.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184757
AA Change: F333L

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139377
Gene: ENSMUSG00000032360
AA Change: F333L

DomainStartEndE-ValueType
Pfam:7tm_1 71 364 1.2e-59 PFAM
Pfam:Orexin_rec2 383 443 2.2e-47 PFAM
Meta Mutation Damage Score 0.2353 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor involved in the regulation of feeding behavior. The encoded protein binds the hypothalamic neuropeptides orexin A and orexin B. A related gene (HCRTR1) encodes a G-protein coupled receptor that selectively binds orexin A. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice bearing targeted mutations in this gene exhibit fragmentation of sleep/wake states with similarity to narcolepsy and rare or very rare episodes of cataplexy. In addition, mice homozygous for a funtionally null allele display enhanced depression-likebehavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,419,822 V675D possibly damaging Het
Adamts16 T C 13: 70,753,226 T911A probably benign Het
Adgra1 T C 7: 139,847,703 F62S possibly damaging Het
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
Aff1 T A 5: 103,754,706 M1K probably null Het
AI429214 C T 8: 36,993,917 S73L probably benign Het
Apc C A 18: 34,269,259 probably benign Het
Apcs T C 1: 172,894,563 Y72C probably damaging Het
Arid4a T C 12: 71,061,525 probably benign Het
Armcx4 C A X: 134,691,025 Q561K probably benign Het
Atp5o C T 16: 91,928,906 R64H probably damaging Het
Bank1 G A 3: 136,247,773 probably benign Het
Ccdc150 A G 1: 54,356,773 D805G probably benign Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Dnah1 A T 14: 31,269,817 M3076K possibly damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Egfem1 C T 3: 29,583,021 T202I probably damaging Het
Fam120b T A 17: 15,431,635 probably benign Het
Frem1 T C 4: 82,963,179 T1263A possibly damaging Het
Gm6802 C A 12: 19,490,620 noncoding transcript Het
Golga2 C A 2: 32,302,942 A424E probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Grik5 T C 7: 25,062,972 D198G probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Htr1b A C 9: 81,632,041 V171G probably benign Het
Kalrn G T 16: 34,212,272 D1117E probably benign Het
Kcp T C 6: 29,482,846 N1408S possibly damaging Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Klra17 T A 6: 129,874,846 N21I probably damaging Het
Lrrc8d A T 5: 105,826,706 noncoding transcript Het
Mast2 C G 4: 116,310,910 E881Q possibly damaging Het
Mcm6 T C 1: 128,351,585 T155A probably benign Het
Mslnl T C 17: 25,744,517 F326L probably benign Het
Nlrp4c A G 7: 6,092,570 K816E possibly damaging Het
Olfr1047 T C 2: 86,228,642 S110G probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr1510 T A 14: 52,410,361 R170S possibly damaging Het
Olfr494 A T 7: 108,368,344 I285F possibly damaging Het
Otoa A G 7: 121,122,043 Q427R probably damaging Het
Pcdhb6 A G 18: 37,335,892 E622G probably damaging Het
Pdzd8 A G 19: 59,345,413 Y59H probably damaging Het
Psmc3 A C 2: 91,055,918 D159A probably damaging Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Rpn2 C A 2: 157,290,652 A108E possibly damaging Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Slc16a4 G A 3: 107,300,872 E233K probably benign Het
Smu1 T C 4: 40,752,008 T183A probably benign Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Styxl1 T C 5: 135,765,764 Y83C probably damaging Het
Sypl2 C T 3: 108,216,729 V166I possibly damaging Het
Tal2 A G 4: 53,785,843 N8S probably damaging Het
Tenm4 T C 7: 96,852,530 Y1314H probably damaging Het
Ttn A C 2: 76,942,405 N2415K possibly damaging Het
Usp53 T C 3: 122,949,858 probably null Het
Vmn2r65 T C 7: 84,946,688 I263V probably benign Het
Other mutations in Hcrtr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Hcrtr2 APN 9 76228155 missense possibly damaging 0.86
IGL00492:Hcrtr2 APN 9 76246441 missense probably damaging 1.00
IGL00782:Hcrtr2 APN 9 76230497 utr 3 prime probably benign
IGL03096:Hcrtr2 APN 9 76254626 missense probably benign 0.01
PIT4508001:Hcrtr2 UTSW 9 76246380 nonsense probably null
R0038:Hcrtr2 UTSW 9 76259681 missense probably benign 0.00
R0038:Hcrtr2 UTSW 9 76259681 missense probably benign 0.00
R0268:Hcrtr2 UTSW 9 76228188 missense probably benign
R0389:Hcrtr2 UTSW 9 76246380 nonsense probably null
R0499:Hcrtr2 UTSW 9 76254672 missense probably damaging 1.00
R0607:Hcrtr2 UTSW 9 76230684 missense probably benign 0.00
R1622:Hcrtr2 UTSW 9 76323440 missense probably benign 0.03
R1637:Hcrtr2 UTSW 9 76232999 missense probably benign
R1698:Hcrtr2 UTSW 9 76246453 missense probably damaging 1.00
R1856:Hcrtr2 UTSW 9 76259785 missense probably damaging 1.00
R1876:Hcrtr2 UTSW 9 76246345 critical splice donor site probably null
R4469:Hcrtr2 UTSW 9 76230556 missense probably benign 0.30
R4560:Hcrtr2 UTSW 9 76254688 missense probably damaging 1.00
R4797:Hcrtr2 UTSW 9 76254534 missense probably damaging 1.00
R5001:Hcrtr2 UTSW 9 76230604 missense probably benign 0.00
R5027:Hcrtr2 UTSW 9 76323296 missense probably benign 0.31
R5611:Hcrtr2 UTSW 9 76323314 missense probably damaging 0.98
R5770:Hcrtr2 UTSW 9 76259666 missense probably damaging 0.98
R5826:Hcrtr2 UTSW 9 76323287 missense probably benign 0.32
R6023:Hcrtr2 UTSW 9 76230604 missense probably benign 0.00
R6110:Hcrtr2 UTSW 9 76259782 missense probably damaging 1.00
R7084:Hcrtr2 UTSW 9 76230660 missense probably benign 0.21
R7103:Hcrtr2 UTSW 9 76254511 missense probably benign 0.00
R7173:Hcrtr2 UTSW 9 76259731 missense probably damaging 1.00
R7783:Hcrtr2 UTSW 9 76232914 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACTTTAGAATTGCCTCGGGG -3'
(R):5'- TTGCATTTCCTGGTTGCAAG -3'

Sequencing Primer
(F):5'- GGGCATCTGCTCTAGAAACTC -3'
(R):5'- GCAAGACATGGAGACTTTTTCTGAGC -3'
Posted On2015-02-18