Incidental Mutation 'R3413:Slc1a7'
ID267795
Institutional Source Beutler Lab
Gene Symbol Slc1a7
Ensembl Gene ENSMUSG00000008932
Gene Namesolute carrier family 1 (glutamate transporter), member 7
SynonymsEAAT5
MMRRC Submission 040631-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R3413 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location107968332-108013532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108010994 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 497 (E497G)
Ref Sequence ENSEMBL: ENSMUSP00000102324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044248] [ENSMUST00000106708] [ENSMUST00000106709] [ENSMUST00000106713] [ENSMUST00000146851]
Predicted Effect probably benign
Transcript: ENSMUST00000044248
SMART Domains Protein: ENSMUSP00000048962
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106708
SMART Domains Protein: ENSMUSP00000102319
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106709
SMART Domains Protein: ENSMUSP00000102320
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106713
AA Change: E497G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000102324
Gene: ENSMUSG00000008932
AA Change: E497G

DomainStartEndE-ValueType
Pfam:SDF 29 485 1.9e-127 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145491
Predicted Effect probably benign
Transcript: ENSMUST00000146851
SMART Domains Protein: ENSMUSP00000121478
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
LRR 1 24 1.19e1 SMART
LRR 47 71 2.84e1 SMART
LRR 94 116 6.22e0 SMART
LRR 117 142 3.47e0 SMART
LRR_TYP 143 166 7.9e-4 SMART
LRR 188 213 1.26e1 SMART
LRR 214 237 2.82e0 SMART
LRR 262 284 1.53e2 SMART
LRR_TYP 285 308 7.37e-4 SMART
low complexity region 319 334 N/A INTRINSIC
low complexity region 359 364 N/A INTRINSIC
Meta Mutation Damage Score 0.0758 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,987,387 probably benign Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Axin1 A G 17: 26,188,038 H535R probably damaging Het
Ccnb3 T A X: 7,007,801 E846D probably benign Het
Cdca7 G A 2: 72,485,287 G365R probably damaging Het
Clvs2 T A 10: 33,622,971 probably benign Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Ddx42 A G 11: 106,247,810 T812A probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
Got1l1 A G 8: 27,199,836 probably null Het
Hip1 T C 5: 135,422,172 E451G probably damaging Het
Hs6st2 C T X: 51,681,455 V50I possibly damaging Het
Ighv1-23 C T 12: 114,764,467 V112I probably benign Het
Map1s A G 8: 70,912,519 N107D probably damaging Het
Mmel1 T A 4: 154,889,586 V361D probably damaging Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nup210 G T 6: 91,025,242 Q755K probably benign Het
Olfr114 A G 17: 37,589,696 V219A probably benign Het
Olfr638 A G 7: 104,003,832 M186V probably damaging Het
Pih1h3b T A X: 140,106,021 N216K possibly damaging Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Sspo C T 6: 48,480,697 R3178C probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syk A G 13: 52,631,739 D327G probably benign Het
Tbc1d8b C T X: 139,713,391 A391V probably benign Het
Tmed9 A G 13: 55,595,574 E173G probably benign Het
Top1mt T C 15: 75,657,176 N573S probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Zfp92 C T X: 73,420,294 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Slc1a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Slc1a7 APN 4 107992965 missense probably damaging 1.00
IGL02643:Slc1a7 APN 4 108012300 missense possibly damaging 0.86
IGL03146:Slc1a7 APN 4 107992992 missense probably damaging 0.98
R1023:Slc1a7 UTSW 4 108007573 missense probably damaging 1.00
R1629:Slc1a7 UTSW 4 108008143 missense probably damaging 1.00
R1869:Slc1a7 UTSW 4 108008364 missense probably damaging 1.00
R1957:Slc1a7 UTSW 4 107968585 missense probably benign 0.05
R1970:Slc1a7 UTSW 4 107968585 missense probably benign 0.05
R1971:Slc1a7 UTSW 4 107968585 missense probably benign 0.05
R2058:Slc1a7 UTSW 4 108004439 missense probably benign 0.41
R2201:Slc1a7 UTSW 4 107993006 missense probably damaging 1.00
R2212:Slc1a7 UTSW 4 108010994 missense probably benign 0.02
R3412:Slc1a7 UTSW 4 108010994 missense probably benign 0.02
R3414:Slc1a7 UTSW 4 108010994 missense probably benign 0.02
R3734:Slc1a7 UTSW 4 107977644 missense probably damaging 1.00
R4109:Slc1a7 UTSW 4 107968661 missense probably benign 0.22
R4662:Slc1a7 UTSW 4 108007554 missense probably damaging 1.00
R4676:Slc1a7 UTSW 4 107977674 missense possibly damaging 0.95
R4801:Slc1a7 UTSW 4 107993040 missense probably damaging 1.00
R4802:Slc1a7 UTSW 4 107993040 missense probably damaging 1.00
R4935:Slc1a7 UTSW 4 108007561 missense probably damaging 1.00
R5896:Slc1a7 UTSW 4 108012390 missense probably benign 0.02
R5947:Slc1a7 UTSW 4 108010300 unclassified probably benign
R6056:Slc1a7 UTSW 4 108012261 missense probably benign 0.00
R6088:Slc1a7 UTSW 4 108012444 missense probably damaging 1.00
R6134:Slc1a7 UTSW 4 108012436 missense probably damaging 1.00
R6141:Slc1a7 UTSW 4 108002182 missense possibly damaging 0.50
R7378:Slc1a7 UTSW 4 108002203 missense possibly damaging 0.50
R7587:Slc1a7 UTSW 4 108010486 missense possibly damaging 0.93
R7974:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R7975:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8002:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8003:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8022:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8023:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8075:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8142:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8145:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8205:Slc1a7 UTSW 4 108008311 missense probably benign 0.12
R8257:Slc1a7 UTSW 4 108008197 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGAGTGTGGCTCTCTACCAG -3'
(R):5'- AACATCTGGACCTCTGCAGC -3'

Sequencing Primer
(F):5'- AGTTCCCCACTGAGGTTGCTG -3'
(R):5'- TTGTGGTGACCCCCAACCATAG -3'
Posted On2015-02-18