Incidental Mutation 'R3741:Bbip1'
ID270390
Institutional Source Beutler Lab
Gene Symbol Bbip1
Ensembl Gene ENSMUSG00000084957
Gene NameBBSome interacting protein 1
Synonyms4930560M04Rik, 2310002J21Rik, Ncrna00081, 2610002B11Rik
MMRRC Submission 040727-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R3741 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location53929677-53944627 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 53932175 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000136324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025931] [ENSMUST00000074371] [ENSMUST00000135402] [ENSMUST00000165617]
Predicted Effect probably benign
Transcript: ENSMUST00000025931
SMART Domains Protein: ENSMUSP00000025931
Gene: ENSMUSG00000024975

DomainStartEndE-ValueType
low complexity region 66 82 N/A INTRINSIC
low complexity region 96 122 N/A INTRINSIC
MA3 164 275 3.68e-41 SMART
MA3 327 440 5.01e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074371
SMART Domains Protein: ENSMUSP00000073975
Gene: ENSMUSG00000024975

DomainStartEndE-ValueType
low complexity region 66 82 N/A INTRINSIC
low complexity region 96 122 N/A INTRINSIC
MA3 164 275 3.68e-41 SMART
MA3 327 440 5.01e-43 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135402
AA Change: M1V

PolyPhen 2 Score 0.578 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000136324
Gene: ENSMUSG00000084957
AA Change: M1V

DomainStartEndE-ValueType
Pfam:BBIP10 1 64 2.7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165617
SMART Domains Protein: ENSMUSP00000133135
Gene: ENSMUSG00000024975

DomainStartEndE-ValueType
low complexity region 66 82 N/A INTRINSIC
low complexity region 96 122 N/A INTRINSIC
MA3 164 275 3.68e-41 SMART
MA3 327 440 5.01e-43 SMART
Meta Mutation Damage Score 0.7213 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of eight proteins that form the BBSome complex and is essential for its assembly. The BBSome complex is involved in trafficking signal receptors to and from the cilia. Mutations in this gene result in Bardet-Biedl syndrome 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a null mutation display strain dependent postnatal lethality, obesity, hyperphagia, retinal degeneration and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,478,619 V1748A possibly damaging Het
Atp10b A T 11: 43,235,662 S1082C probably damaging Het
Atp8b2 C G 3: 89,946,031 A726P probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bbox1 A G 2: 110,305,577 I19T possibly damaging Het
Bclaf3 T A X: 159,551,832 H41Q probably benign Het
Ctsm T A 13: 61,539,627 Q107L probably benign Het
Ctso G A 3: 81,952,249 V288I probably benign Het
Cyp2a4 A C 7: 26,308,544 K125N probably damaging Het
Dapk1 T C 13: 60,748,200 S701P probably benign Het
Dnah1 A G 14: 31,265,467 probably benign Het
Dnah11 A G 12: 118,131,341 M718T probably benign Het
Dnah2 C A 11: 69,448,469 A3071S probably damaging Het
Epb41l4a A T 18: 33,828,102 probably null Het
Fam135a A T 1: 24,014,811 M1215K probably damaging Het
Gm6489 T A 1: 31,287,683 noncoding transcript Het
Hhipl1 A G 12: 108,318,717 Y443C probably damaging Het
Hoxc13 G A 15: 102,921,438 G84D possibly damaging Het
Ifi207 T C 1: 173,727,562 I851M probably damaging Het
Lipk T G 19: 34,021,707 L134R probably damaging Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Msrb3 A T 10: 120,784,214 F67I probably damaging Het
Myo1a A G 10: 127,714,898 D593G probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup210l A T 3: 90,207,394 M1759L probably benign Het
Optn C A 2: 5,034,198 M371I possibly damaging Het
Rims1 A T 1: 22,373,443 V380D probably damaging Het
Rnf148 A G 6: 23,654,065 C311R possibly damaging Het
Rrp12 T C 19: 41,885,728 D377G probably damaging Het
Sbp T A 17: 23,945,582 probably benign Het
Sipa1 T C 19: 5,654,857 E570G probably damaging Het
Spem2 T C 11: 69,816,730 R470G possibly damaging Het
Syngr4 T C 7: 45,895,770 E5G possibly damaging Het
Tmem88b A G 4: 155,785,427 L59P probably damaging Het
Ttn T A 2: 76,790,359 K13995* probably null Het
Vmn1r69 A G 7: 10,580,142 Y221H possibly damaging Het
Zfp386 T A 12: 116,059,550 L296* probably null Het
Other mutations in Bbip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4610:Bbip1 UTSW 19 53932175 start codon destroyed probably null 0.58
R4982:Bbip1 UTSW 19 53932208 splice site probably null
R5248:Bbip1 UTSW 19 53931355 unclassified probably benign
R6344:Bbip1 UTSW 19 53931481 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGTTCCAGTTGTAAGAAACAGC -3'
(R):5'- CACCTCACCGATTTTCAGGG -3'

Sequencing Primer
(F):5'- GCTTCCTCATGAACAGTGAGAGTAC -3'
(R):5'- CCTCACCGATTTTCAGGGAAGAG -3'
Posted On2015-03-18