Incidental Mutation 'R3787:Mcm9'
ID272323
Institutional Source Beutler Lab
Gene Symbol Mcm9
Ensembl Gene ENSMUSG00000058298
Gene Nameminichromosome maintenance 9 homologous recombination repair factor
SynonymsMcmdc1, 9030408O17Rik
MMRRC Submission 040754-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3787 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location53536315-53630439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53615980 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 415 (V415A)
Ref Sequence ENSEMBL: ENSMUSP00000074978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075540] [ENSMUST00000219838]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075540
AA Change: V415A

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074978
Gene: ENSMUSG00000058298
AA Change: V415A

DomainStartEndE-ValueType
low complexity region 22 44 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
low complexity region 81 111 N/A INTRINSIC
MCM 268 761 9.44e-116 SMART
AAA 500 649 2.43e-6 SMART
coiled coil region 789 817 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1028 N/A INTRINSIC
low complexity region 1045 1056 N/A INTRINSIC
low complexity region 1199 1216 N/A INTRINSIC
low complexity region 1219 1232 N/A INTRINSIC
low complexity region 1246 1255 N/A INTRINSIC
low complexity region 1262 1276 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000218549
AA Change: V363A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219458
Predicted Effect probably benign
Transcript: ENSMUST00000219838
AA Change: V415A

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000219841
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the mini-chromosome maintenance (MCM) protein family that are essential for the initiation of eukaryotic genome replication. Binding of this protein to chromatin has been shown to be a pre-requisite for recruiting the MCM2-7 helicase to DNA replication origins. This protein also binds, and is a positive regulator of, the chromatin licensing and DNA replication factor 1, CDT1. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for gene trap alleles display germ cell loss with reduced fertility or infertility and increased tumor incidence, particulary of hepatocellular carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Aprt T C 8: 122,575,529 D65G probably benign Het
Auh C A 13: 52,929,457 R62L possibly damaging Het
Bmp4 C T 14: 46,385,714 probably null Het
Bptf C A 11: 107,073,827 D1514Y probably damaging Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc112 C T 18: 46,299,298 R72H probably benign Het
Ccdc138 T C 10: 58,538,270 Y371H probably damaging Het
Chsy3 T C 18: 59,408,998 Y403H probably damaging Het
Cul4a T C 8: 13,133,668 V352A probably damaging Het
D5Ertd577e T A 5: 95,482,897 L211Q probably damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Dmxl2 T C 9: 54,369,878 D2893G probably damaging Het
Dnah8 A G 17: 30,755,041 D2800G probably damaging Het
Dnaja2 C T 8: 85,540,386 G281R probably damaging Het
Exo1 A G 1: 175,899,469 T449A probably benign Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Fmo1 A T 1: 162,830,014 S519R possibly damaging Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gpt2 G T 8: 85,525,573 V506L probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Mki67 A T 7: 135,700,283 N1007K possibly damaging Het
Mpped1 A T 15: 83,796,583 probably benign Het
Mtpap T C 18: 4,380,670 V116A probably damaging Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nfs1 A G 2: 156,128,583 I270T possibly damaging Het
Nr1i3 A G 1: 171,214,425 D26G probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Olfr61 G A 7: 140,637,835 V45I probably benign Het
Olfr951 T C 9: 39,394,382 V197A probably benign Het
Pde4dip G T 3: 97,715,552 P1447Q possibly damaging Het
Plxna2 A G 1: 194,643,934 T59A probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r12c G A 7: 4,486,584 A193V probably damaging Het
Prdm15 G T 16: 97,797,745 H904Q probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Reep1 T A 6: 71,795,215 D162E probably damaging Het
Rev3l T A 10: 39,846,210 L2528Q probably damaging Het
Rfc1 A T 5: 65,296,014 S264T probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Sipa1l2 C T 8: 125,423,205 A1602T probably benign Het
Sipa1l2 C A 8: 125,450,383 C1164F possibly damaging Het
Slc4a1ap T A 5: 31,528,139 L254I possibly damaging Het
Slc5a3 A G 16: 92,077,928 N291S possibly damaging Het
Stab2 T A 10: 86,969,277 D279V possibly damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Txnl4b C T 8: 109,572,777 A123V probably damaging Het
Vmn1r63 T A 7: 5,802,752 M294L probably benign Het
Vmn2r58 C T 7: 41,864,074 D382N probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Other mutations in Mcm9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Mcm9 APN 10 53622973 missense probably damaging 0.97
IGL00904:Mcm9 APN 10 53622921 missense possibly damaging 0.89
IGL00943:Mcm9 APN 10 53548589 missense probably damaging 1.00
IGL01019:Mcm9 APN 10 53629945 missense probably damaging 1.00
IGL02452:Mcm9 APN 10 53541557 missense probably damaging 1.00
IGL02481:Mcm9 APN 10 53625937 missense probably damaging 1.00
IGL02982:Mcm9 APN 10 53625826 missense probably damaging 0.99
IGL03300:Mcm9 APN 10 53611427 missense probably damaging 1.00
R0021:Mcm9 UTSW 10 53537901 missense possibly damaging 0.94
R0117:Mcm9 UTSW 10 53537736 missense possibly damaging 0.49
R0137:Mcm9 UTSW 10 53563430 missense possibly damaging 0.95
R0420:Mcm9 UTSW 10 53548527 missense probably benign 0.10
R0499:Mcm9 UTSW 10 53538154 missense probably benign 0.01
R0543:Mcm9 UTSW 10 53541598 missense probably damaging 0.97
R0947:Mcm9 UTSW 10 53537501 small deletion probably benign
R0975:Mcm9 UTSW 10 53538646 nonsense probably null
R1573:Mcm9 UTSW 10 53548656 missense probably damaging 0.97
R1726:Mcm9 UTSW 10 53537881 missense possibly damaging 0.67
R1839:Mcm9 UTSW 10 53541553 missense probably damaging 0.99
R2050:Mcm9 UTSW 10 53612825 critical splice donor site probably null
R2113:Mcm9 UTSW 10 53615847 splice site probably null
R2172:Mcm9 UTSW 10 53548574 missense probably damaging 1.00
R3417:Mcm9 UTSW 10 53537407 missense possibly damaging 0.83
R3755:Mcm9 UTSW 10 53625952 missense probably benign 0.08
R3789:Mcm9 UTSW 10 53616017 missense probably damaging 1.00
R3953:Mcm9 UTSW 10 53563344 missense probably damaging 1.00
R4291:Mcm9 UTSW 10 53547572 missense probably benign 0.22
R4358:Mcm9 UTSW 10 53537653 missense probably benign 0.03
R4660:Mcm9 UTSW 10 53548527 missense probably benign 0.10
R4662:Mcm9 UTSW 10 53548527 missense probably benign 0.10
R5082:Mcm9 UTSW 10 53538060 missense possibly damaging 0.94
R5130:Mcm9 UTSW 10 53630399 missense possibly damaging 0.90
R5193:Mcm9 UTSW 10 53616038 missense probably damaging 0.99
R5238:Mcm9 UTSW 10 53629997 missense possibly damaging 0.83
R5317:Mcm9 UTSW 10 53538234 missense probably damaging 1.00
R5395:Mcm9 UTSW 10 53538692 missense possibly damaging 0.93
R5524:Mcm9 UTSW 10 53548690 nonsense probably null
R5593:Mcm9 UTSW 10 53538297 missense probably damaging 0.99
R5748:Mcm9 UTSW 10 53625729 missense probably damaging 1.00
R6025:Mcm9 UTSW 10 53615977 missense possibly damaging 0.93
R6299:Mcm9 UTSW 10 53537681 missense probably damaging 1.00
R6344:Mcm9 UTSW 10 53537937 missense probably benign 0.03
R6502:Mcm9 UTSW 10 53612839 missense probably damaging 1.00
R6621:Mcm9 UTSW 10 53563313 missense probably damaging 1.00
R6883:Mcm9 UTSW 10 53616014 missense probably damaging 1.00
R6932:Mcm9 UTSW 10 53620203 missense probably benign 0.06
R6963:Mcm9 UTSW 10 53548617 missense probably damaging 1.00
R7094:Mcm9 UTSW 10 53620157 missense probably damaging 1.00
R7114:Mcm9 UTSW 10 53538573 missense possibly damaging 0.55
R7200:Mcm9 UTSW 10 53615923 missense
R7593:Mcm9 UTSW 10 53629992 missense probably benign 0.04
R7671:Mcm9 UTSW 10 53537569 missense probably benign 0.01
R7697:Mcm9 UTSW 10 53615894 missense
R7997:Mcm9 UTSW 10 53597406 start gained probably benign
Z1176:Mcm9 UTSW 10 53537507 missense unknown
Z1176:Mcm9 UTSW 10 53629788 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCAATGCCAGAAACAGACTTGAAG -3'
(R):5'- AACAGATGTCCTTGGAAACAGG -3'

Sequencing Primer
(F):5'- TGCCAGAAACAGACTTGAAGATACTG -3'
(R):5'- ACAGGAAGTTATGGGCAGCTTATTTC -3'
Posted On2015-03-25