Incidental Mutation 'R7351:Plcg2'
ID570579
Institutional Source Beutler Lab
Gene Symbol Plcg2
Ensembl Gene ENSMUSG00000034330
Gene Namephospholipase C, gamma 2
SynonymsPlcg-2, PLCgamma2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7351 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location117498291-117635142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117590310 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 642 (E642G)
Ref Sequence ENSEMBL: ENSMUSP00000079991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081232]
PDB Structure
Crystal structure of the N-terminal SH2 domain of mouse phospholipase C-gamma 2 [X-RAY DIFFRACTION]
Solution structure of the SH3 domain from Phospholipase C, gamma 2 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081232
AA Change: E642G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079991
Gene: ENSMUSG00000034330
AA Change: E642G

DomainStartEndE-ValueType
PH 21 133 1.87e-4 SMART
PLCXc 312 456 2.29e-96 SMART
low complexity region 461 476 N/A INTRINSIC
PDB:2K2J|A 478 516 6e-17 PDB
SH2 530 623 2.24e-30 SMART
SH2 644 726 1.16e-28 SMART
SH3 772 828 3.12e-18 SMART
PH 789 910 4.31e0 SMART
PLCYc 930 1044 1.18e-66 SMART
C2 1062 1167 1.41e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane signaling enzyme that catalyzes the conversion of 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate to 1D-myo-inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) using calcium as a cofactor. IP3 and DAG are second messenger molecules important for transmitting signals from growth factor receptors and immune system receptors across the cell membrane. Mutations in this gene have been found in autoinflammation, antibody deficiency, and immune dysregulation syndrome and familial cold autoinflammatory syndrome 3. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for some null alleles show decreased B cell and impaired NK cell function. Other homozygous null alleles show aberrant separation of blood and lymphatic vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,412,510 G343V probably damaging Het
1700006E09Rik A G 11: 101,991,505 E163G probably benign Het
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Adamts6 G A 13: 104,390,112 S516N possibly damaging Het
Ahi1 A G 10: 20,965,933 D301G probably damaging Het
Arhgef37 T A 18: 61,498,215 L566F possibly damaging Het
AU040320 A G 4: 126,816,444 N328D probably damaging Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Brk1 T C 6: 113,615,781 S42P probably benign Het
Ccdc180 A G 4: 45,903,887 E351G possibly damaging Het
Cenpo A T 12: 4,216,581 F176I probably damaging Het
Clec12b A G 6: 129,379,911 probably null Het
Ddx42 A G 11: 106,247,682 N769S probably benign Het
Drc7 A G 8: 95,058,507 D165G probably benign Het
Dync2h1 A T 9: 7,167,145 I486N probably damaging Het
Gmip A G 8: 69,817,384 D679G probably benign Het
Gml2 T C 15: 74,821,376 V76A possibly damaging Het
Gpr26 T C 7: 131,974,365 C253R probably damaging Het
H2-Q4 A G 17: 35,382,878 T239A possibly damaging Het
Hmcn1 T A 1: 150,667,889 Y2845F probably damaging Het
Ift172 A G 5: 31,275,896 Y550H probably damaging Het
Irgm2 G A 11: 58,219,605 V41M possibly damaging Het
Lrp2 C T 2: 69,448,142 G3956R probably damaging Het
Matn2 G A 15: 34,345,336 R163H probably damaging Het
Mxd1 A G 6: 86,651,466 S151P probably damaging Het
Olfr1022 G T 2: 85,864,071 probably benign Het
Olfr1246 C T 2: 89,590,513 G201S probably benign Het
Olfr1330 T C 4: 118,893,836 V251A probably benign Het
Olfr147 C T 9: 38,403,443 L190F probably damaging Het
Pramel6 T A 2: 87,510,328 F335I probably benign Het
Psd G T 19: 46,322,430 S393R probably benign Het
Pwwp2a A G 11: 43,682,280 D63G probably benign Het
Rbm28 T C 6: 29,158,880 T139A probably benign Het
Ripk2 T G 4: 16,155,048 E157A probably damaging Het
Rnf145 G A 11: 44,548,796 V140I possibly damaging Het
Rnf38 T C 4: 44,149,102 N114D probably benign Het
Samd9l G A 6: 3,374,157 R1035C probably benign Het
Sec14l3 A G 11: 4,074,785 T245A probably benign Het
Serpina10 A T 12: 103,628,935 F8L probably benign Het
Slc16a8 T A 15: 79,253,641 D56V probably damaging Het
Spag9 A T 11: 94,092,976 E726D probably benign Het
Spg11 A G 2: 122,069,931 F1547L possibly damaging Het
Sspo T C 6: 48,464,921 I1955T possibly damaging Het
Stx18 T A 5: 38,039,411 V27E probably benign Het
Taf1c A G 8: 119,599,000 S708P probably damaging Het
Tas2r126 T C 6: 42,435,306 F258L probably benign Het
Tdpoz2 C T 3: 93,652,593 W24* probably null Het
Tmc8 T C 11: 117,783,828 L123P probably damaging Het
Trmo A T 4: 46,387,716 Y35N possibly damaging Het
Ttn C T 2: 76,767,686 V19628I possibly damaging Het
Ttn G A 2: 76,939,930 A2685V unknown Het
Usp15 A T 10: 123,132,999 M349K probably damaging Het
Vmn2r89 A G 14: 51,456,282 N363S probably benign Het
Vwa3a T A 7: 120,776,336 I423N probably damaging Het
Zfp592 T C 7: 81,041,691 V1206A probably benign Het
Zfp866 A T 8: 69,765,897 Y358N probably damaging Het
Other mutations in Plcg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Plcg2 APN 8 117556071 missense possibly damaging 0.89
IGL00911:Plcg2 APN 8 117586515 missense probably benign 0.17
IGL00952:Plcg2 APN 8 117607217 missense probably benign
IGL01115:Plcg2 APN 8 117557329 missense probably damaging 1.00
IGL01326:Plcg2 APN 8 117573999 splice site probably benign
IGL01357:Plcg2 APN 8 117614161 splice site probably benign
IGL01705:Plcg2 APN 8 117581662 missense probably damaging 1.00
IGL01755:Plcg2 APN 8 117621241 missense possibly damaging 0.48
IGL01828:Plcg2 APN 8 117590233 missense probably damaging 1.00
IGL02307:Plcg2 APN 8 117579896 critical splice donor site probably null
IGL02345:Plcg2 APN 8 117585180 missense probably damaging 0.99
IGL02448:Plcg2 APN 8 117607221 missense probably benign
IGL02587:Plcg2 APN 8 117558113 missense possibly damaging 0.80
IGL02646:Plcg2 APN 8 117603883 missense possibly damaging 0.88
IGL03409:Plcg2 APN 8 117583495 missense probably damaging 0.96
Poseidon UTSW 8 117615238 missense probably damaging 1.00
Poseidon2 UTSW 8 117577874 missense possibly damaging 0.80
queen UTSW 8 117581707 missense probably benign 0.00
Seahorse UTSW 8 117589835 splice site probably null
Teleost UTSW 8 117583549 missense probably damaging 1.00
Theseus UTSW 8 117596332 missense probably damaging 0.99
trident UTSW 8 117612978 missense probably benign 0.00
R0172:Plcg2 UTSW 8 117579782 missense probably benign 0.00
R0194:Plcg2 UTSW 8 117573397 splice site probably benign
R0410:Plcg2 UTSW 8 117615373 missense probably damaging 0.98
R0462:Plcg2 UTSW 8 117585305 missense probably benign 0.06
R0494:Plcg2 UTSW 8 117556104 missense probably damaging 1.00
R0522:Plcg2 UTSW 8 117614288 splice site probably null
R0612:Plcg2 UTSW 8 117573365 missense probably benign 0.01
R1239:Plcg2 UTSW 8 117556044 missense probably benign
R1367:Plcg2 UTSW 8 117615238 missense probably damaging 1.00
R1608:Plcg2 UTSW 8 117614235 missense possibly damaging 0.89
R1756:Plcg2 UTSW 8 117592708 missense probably benign 0.02
R2176:Plcg2 UTSW 8 117612994 missense probably damaging 1.00
R3500:Plcg2 UTSW 8 117612978 missense probably benign 0.00
R4043:Plcg2 UTSW 8 117612978 missense probably benign 0.00
R4654:Plcg2 UTSW 8 117504315 missense probably benign
R4883:Plcg2 UTSW 8 117607133 nonsense probably null
R4932:Plcg2 UTSW 8 117607083 missense probably benign 0.05
R5080:Plcg2 UTSW 8 117590003 missense probably benign 0.10
R5226:Plcg2 UTSW 8 117577874 missense possibly damaging 0.80
R5264:Plcg2 UTSW 8 117634793 missense possibly damaging 0.95
R5298:Plcg2 UTSW 8 117605249 missense probably benign
R5473:Plcg2 UTSW 8 117634401 missense probably benign
R5555:Plcg2 UTSW 8 117612995 nonsense probably null
R5557:Plcg2 UTSW 8 117586557 missense probably damaging 0.99
R5805:Plcg2 UTSW 8 117598495 critical splice donor site probably null
R5826:Plcg2 UTSW 8 117610844 missense probably benign 0.19
R5871:Plcg2 UTSW 8 117504217 missense probably damaging 1.00
R5894:Plcg2 UTSW 8 117504349 missense probably damaging 0.99
R6142:Plcg2 UTSW 8 117585271 missense probably benign
R6609:Plcg2 UTSW 8 117568170 missense probably benign 0.31
R6684:Plcg2 UTSW 8 117596332 missense probably damaging 0.99
R6710:Plcg2 UTSW 8 117557347 missense probably benign 0.05
R6931:Plcg2 UTSW 8 117557319 missense probably benign 0.24
R6946:Plcg2 UTSW 8 117504190 missense probably benign
R7036:Plcg2 UTSW 8 117596306 missense probably benign
R7070:Plcg2 UTSW 8 117596306 missense probably benign
R7072:Plcg2 UTSW 8 117589835 splice site probably null
R7214:Plcg2 UTSW 8 117583549 missense probably damaging 1.00
R7393:Plcg2 UTSW 8 117579825 missense possibly damaging 0.90
R7443:Plcg2 UTSW 8 117504289 missense probably benign 0.00
R7513:Plcg2 UTSW 8 117579853 missense probably damaging 0.99
R7609:Plcg2 UTSW 8 117558113 missense probably benign 0.01
X0027:Plcg2 UTSW 8 117555983 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTCTATTCCCAACAGGCGG -3'
(R):5'- GTGGCCTAGTACCTACACAAG -3'

Sequencing Primer
(F):5'- GGTCTGGCCGGGTGCAG -3'
(R):5'- AGAGTGAGTGCTCTTAACCAGTTCC -3'
Posted On2019-09-13