Incidental Mutation 'R3853:Nynrin'
ID276030
Institutional Source Beutler Lab
Gene Symbol Nynrin
Ensembl Gene ENSMUSG00000075592
Gene NameNYN domain and retroviral integrase containing
Synonyms
MMRRC Submission 040900-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3853 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55854010-55874736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55864105 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 410 (N410K)
Ref Sequence ENSEMBL: ENSMUSP00000129557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100529] [ENSMUST00000168479] [ENSMUST00000227465]
Predicted Effect probably benign
Transcript: ENSMUST00000100529
AA Change: N410K

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000098098
Gene: ENSMUSG00000075592
AA Change: N410K

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 1.6e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168479
AA Change: N410K

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129557
Gene: ENSMUSG00000075592
AA Change: N410K

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 5.5e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181218
Predicted Effect probably benign
Transcript: ENSMUST00000227465
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,346 H316L probably damaging Het
AI481877 T C 4: 59,047,390 N1410D possibly damaging Het
Cadps A G 14: 12,509,090 probably benign Het
Cluh A G 11: 74,656,453 D44G probably benign Het
Copb1 A G 7: 114,223,316 V726A probably damaging Het
Dsg4 T C 18: 20,449,234 V79A probably benign Het
Exo1 A T 1: 175,892,988 I291F probably benign Het
Eya4 C T 10: 23,116,676 A460T probably damaging Het
Gjc1 G T 11: 102,800,126 D350E probably benign Het
Hcar2 T C 5: 123,864,412 M343V probably benign Het
Ifna15 T C 4: 88,557,809 Y146C probably damaging Het
Lce3e C T 3: 92,967,832 Q32* probably null Het
Llgl1 T C 11: 60,707,249 L373P probably damaging Het
Mark2 A G 19: 7,277,290 C642R probably damaging Het
Mbd3l2 A G 9: 18,444,796 Q139R probably benign Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mum1l1 C T X: 139,236,654 probably null Het
Olfr1243 A T 2: 89,527,573 M279K possibly damaging Het
Olfr1354 T A 10: 78,916,947 Y36N probably damaging Het
Olfr1466 A G 19: 13,342,498 T247A possibly damaging Het
Olfr906 G T 9: 38,488,951 R307S probably benign Het
Olfr978 A T 9: 39,994,154 T115S probably damaging Het
Padi3 T C 4: 140,791,269 probably benign Het
Prkce A G 17: 86,168,849 D86G probably damaging Het
Rad21 T G 15: 51,972,316 I234L probably benign Het
Scn4a A T 11: 106,320,106 M1695K possibly damaging Het
Sdccag8 T C 1: 176,853,795 S325P probably damaging Het
Sebox G A 11: 78,504,149 G106R probably benign Het
Serpinb9 A G 13: 33,015,520 E266G possibly damaging Het
Snx14 T C 9: 88,407,319 probably benign Het
Tmc6 A T 11: 117,773,058 L474* probably null Het
Tmem132c T C 5: 127,359,869 Y141H probably benign Het
Trap1 G A 16: 4,054,822 R328C possibly damaging Het
Trim36 C A 18: 46,172,372 probably benign Het
Trmt2a A T 16: 18,251,191 Y299F possibly damaging Het
Trrap A G 5: 144,792,165 K630E probably damaging Het
Tsnaxip1 A T 8: 105,840,701 probably benign Het
Ttc6 G T 12: 57,728,549 C1677F possibly damaging Het
Ugt2a3 A T 5: 87,337,159 V2D possibly damaging Het
Usp9x A G X: 13,098,583 D77G probably benign Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zan A C 5: 137,474,064 L140R probably damaging Het
Zc3h3 A T 15: 75,837,497 S508T probably benign Het
Zswim3 A G 2: 164,820,857 Y419C possibly damaging Het
Other mutations in Nynrin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Nynrin APN 14 55868448 missense probably benign 0.38
IGL01131:Nynrin APN 14 55872685 missense probably damaging 1.00
IGL01357:Nynrin APN 14 55870417 missense probably benign
IGL01537:Nynrin APN 14 55872045 missense possibly damaging 0.87
IGL01583:Nynrin APN 14 55870511 missense probably damaging 1.00
IGL01726:Nynrin APN 14 55864154 missense probably benign
IGL02161:Nynrin APN 14 55863984 missense probably damaging 1.00
IGL02167:Nynrin APN 14 55863335 missense probably damaging 1.00
IGL02247:Nynrin APN 14 55871710 nonsense probably null
IGL02302:Nynrin APN 14 55868505 missense probably benign 0.43
IGL02524:Nynrin APN 14 55871474 missense possibly damaging 0.73
IGL02600:Nynrin APN 14 55863992 missense probably benign 0.38
IGL02639:Nynrin APN 14 55870655 missense probably damaging 1.00
IGL02654:Nynrin APN 14 55863259 missense possibly damaging 0.95
IGL02659:Nynrin APN 14 55866097 unclassified probably benign
IGL02736:Nynrin APN 14 55870909 missense probably damaging 1.00
IGL02949:Nynrin APN 14 55872380 missense probably damaging 0.99
PIT4458001:Nynrin UTSW 14 55863968 missense probably benign 0.39
R0017:Nynrin UTSW 14 55872395 missense probably damaging 1.00
R0078:Nynrin UTSW 14 55863332 missense probably damaging 1.00
R0211:Nynrin UTSW 14 55871798 missense probably benign 0.08
R0211:Nynrin UTSW 14 55871798 missense probably benign 0.08
R0413:Nynrin UTSW 14 55872191 missense possibly damaging 0.90
R0609:Nynrin UTSW 14 55872761 missense probably damaging 1.00
R0626:Nynrin UTSW 14 55868035 missense probably damaging 1.00
R1205:Nynrin UTSW 14 55854189 intron probably benign
R1222:Nynrin UTSW 14 55863541 missense probably benign 0.02
R1385:Nynrin UTSW 14 55864899 missense probably benign 0.00
R1820:Nynrin UTSW 14 55870378 missense possibly damaging 0.95
R1829:Nynrin UTSW 14 55872947 missense possibly damaging 0.50
R1874:Nynrin UTSW 14 55863493 missense probably benign 0.04
R1927:Nynrin UTSW 14 55863592 missense probably benign 0.00
R2233:Nynrin UTSW 14 55872067 missense possibly damaging 0.83
R3018:Nynrin UTSW 14 55863410 missense probably benign 0.00
R3154:Nynrin UTSW 14 55863587 missense possibly damaging 0.46
R4648:Nynrin UTSW 14 55872894 nonsense probably null
R4722:Nynrin UTSW 14 55854395 missense probably damaging 0.97
R4735:Nynrin UTSW 14 55870168 missense probably benign 0.03
R4736:Nynrin UTSW 14 55863997 missense probably damaging 1.00
R4780:Nynrin UTSW 14 55863263 missense probably damaging 1.00
R4804:Nynrin UTSW 14 55864869 missense probably benign
R4816:Nynrin UTSW 14 55872001 missense probably damaging 1.00
R5307:Nynrin UTSW 14 55863806 missense probably damaging 1.00
R5372:Nynrin UTSW 14 55868491 missense probably benign 0.01
R5432:Nynrin UTSW 14 55864466 missense possibly damaging 0.80
R5800:Nynrin UTSW 14 55870631 missense probably damaging 1.00
R5825:Nynrin UTSW 14 55864226 missense probably benign 0.00
R6149:Nynrin UTSW 14 55854323 missense possibly damaging 0.83
R6244:Nynrin UTSW 14 55868028 missense probably damaging 1.00
R6350:Nynrin UTSW 14 55868076 missense probably benign 0.19
R6379:Nynrin UTSW 14 55870391 missense probably damaging 1.00
R6437:Nynrin UTSW 14 55871770 missense probably benign 0.00
R6501:Nynrin UTSW 14 55863532 missense probably benign
R6702:Nynrin UTSW 14 55864478 missense possibly damaging 0.80
R6703:Nynrin UTSW 14 55864478 missense possibly damaging 0.80
R6907:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6908:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6928:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6934:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6935:Nynrin UTSW 14 55863878 missense probably benign 0.20
R7197:Nynrin UTSW 14 55871923 missense probably benign 0.00
R7204:Nynrin UTSW 14 55872733 missense probably damaging 1.00
R7272:Nynrin UTSW 14 55870415 missense probably damaging 1.00
R7335:Nynrin UTSW 14 55863914 missense probably benign
R7361:Nynrin UTSW 14 55870400 missense possibly damaging 0.71
R7368:Nynrin UTSW 14 55870511 missense probably damaging 1.00
R7443:Nynrin UTSW 14 55871416 missense probably benign 0.18
R7584:Nynrin UTSW 14 55871584 missense probably damaging 1.00
R7677:Nynrin UTSW 14 55870236 missense probably benign
R7723:Nynrin UTSW 14 55872045 missense possibly damaging 0.87
R7776:Nynrin UTSW 14 55865963 missense probably damaging 1.00
R7787:Nynrin UTSW 14 55870523 missense probably benign
R7842:Nynrin UTSW 14 55865096 missense probably damaging 1.00
R7852:Nynrin UTSW 14 55871429 missense probably damaging 0.96
R7925:Nynrin UTSW 14 55865096 missense probably damaging 1.00
R7935:Nynrin UTSW 14 55871429 missense probably damaging 0.96
R8040:Nynrin UTSW 14 55871525 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACATCCTGGAAGGTCTGG -3'
(R):5'- TGAAGACTGCCCTACTTGC -3'

Sequencing Primer
(F):5'- TGGAAGGTCTGGGCCCC -3'
(R):5'- AGAAGTCCCGGGCTAACCTTC -3'
Posted On2015-04-06