Incidental Mutation 'R7842:Nynrin'
ID606408
Institutional Source Beutler Lab
Gene Symbol Nynrin
Ensembl Gene ENSMUSG00000075592
Gene NameNYN domain and retroviral integrase containing
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7842 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55854010-55874736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55865096 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 741 (R741G)
Ref Sequence ENSEMBL: ENSMUSP00000098098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100529] [ENSMUST00000168479] [ENSMUST00000227465]
Predicted Effect probably damaging
Transcript: ENSMUST00000100529
AA Change: R741G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098098
Gene: ENSMUSG00000075592
AA Change: R741G

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 1.6e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168479
AA Change: R741G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129557
Gene: ENSMUSG00000075592
AA Change: R741G

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 5.5e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227465
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,953,536 T3A unknown Het
4933412E24Rik T C 15: 60,016,573 E6G probably damaging Het
Abca6 A G 11: 110,196,697 L1135P possibly damaging Het
Agps A G 2: 75,851,532 D113G probably damaging Het
Ankhd1 G T 18: 36,647,828 V1978L probably benign Het
Ankrd31 T A 13: 96,821,458 probably null Het
Arhgap5 T A 12: 52,518,697 M817K possibly damaging Het
Bdp1 C A 13: 100,099,129 V105F probably damaging Het
Brdt A G 5: 107,348,588 N189D possibly damaging Het
Ccdc180 A T 4: 45,909,428 N532I probably benign Het
Ccnc A C 4: 21,730,480 K39T probably damaging Het
Cfap57 C A 4: 118,554,755 G1231* probably null Het
Chd7 A T 4: 8,854,115 T1896S probably benign Het
Clk4 A T 11: 51,281,129 H412L probably benign Het
Creld1 T C 6: 113,488,139 L109P probably damaging Het
Cxxc4 A T 3: 134,240,332 I225L possibly damaging Het
Cyp4f39 A T 17: 32,483,317 R263W probably benign Het
Dip2c T C 13: 9,606,533 probably null Het
Dnah14 A G 1: 181,627,898 T863A probably damaging Het
Dnah17 C A 11: 118,079,682 probably null Het
Dnajc10 A G 2: 80,345,065 K599E probably benign Het
Dnajc7 C A 11: 100,598,718 R101L probably benign Het
Dnttip2 G A 3: 122,276,341 E402K probably benign Het
Dusp22 T A 13: 30,668,791 probably null Het
Egflam C A 15: 7,251,194 R450M probably null Het
Eml5 C T 12: 98,794,135 R1785Q probably damaging Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fam45a G A 19: 60,830,879 A263T not run Het
Fam78b G T 1: 167,001,609 R15L probably damaging Het
Fbxl5 A T 5: 43,758,603 I489N probably damaging Het
Flt3 G A 5: 147,334,453 P893S probably damaging Het
Gm17019 T C 5: 15,031,035 M131V possibly damaging Het
Gm21560 T A 14: 6,216,262 I194F probably benign Het
Gm28729 T C 9: 96,517,652 D158G probably damaging Het
Gucy2c C T 6: 136,769,816 probably null Het
Hectd1 C T 12: 51,772,560 G1247S probably damaging Het
Ireb2 T A 9: 54,909,686 I946K probably benign Het
Itgb4 A T 11: 115,982,705 D249V probably benign Het
Klhdc7a A G 4: 139,967,238 S133P probably damaging Het
Lsr A T 7: 30,966,012 D172E possibly damaging Het
Macf1 T C 4: 123,526,909 E184G probably benign Het
Map2 T A 1: 66,416,411 D1421E probably benign Het
Map3k4 A T 17: 12,271,143 L467H possibly damaging Het
Mogat1 T C 1: 78,522,865 probably null Het
Mxra8 A G 4: 155,842,910 D384G probably damaging Het
Myo15b A G 11: 115,871,495 T1214A Het
Naip1 T C 13: 100,426,998 Y553C probably damaging Het
Nln A T 13: 104,052,629 I278K probably benign Het
Nsmaf T A 4: 6,435,109 probably null Het
Olfr1045 G T 2: 86,198,172 Y193* probably null Het
Olfr1166 C T 2: 88,124,986 probably benign Het
Olfr1208 A G 2: 88,896,961 V212A possibly damaging Het
Olfr603 A G 7: 103,383,576 V142A probably benign Het
Orc1 A G 4: 108,605,547 H607R probably benign Het
Pate2 A T 9: 35,670,533 Y41F probably damaging Het
Pcdhb20 A T 18: 37,505,059 T213S possibly damaging Het
Pcm1 G A 8: 41,327,584 E1858K possibly damaging Het
Pla2g2d A G 4: 138,778,778 T59A probably damaging Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Prl2c2 A G 13: 13,005,322 L2P probably benign Het
Proz G A 8: 13,063,406 V76I probably benign Het
Prr36 A G 8: 4,210,953 S955P probably benign Het
Pter T C 2: 12,978,541 V119A probably damaging Het
Qrich1 T A 9: 108,556,368 probably null Het
Rbm15b T C 9: 106,885,889 E360G probably damaging Het
Skint11 G A 4: 114,244,771 C327Y possibly damaging Het
Spag17 T A 3: 100,053,858 S987T probably benign Het
Tbx1 T C 16: 18,586,615 S100G unknown Het
Tiam2 C T 17: 3,518,124 S1515L possibly damaging Het
Togaram1 C A 12: 64,966,459 D161E probably damaging Het
Trhde A T 10: 114,696,098 S366T possibly damaging Het
Ttc12 A G 9: 49,438,424 I691T possibly damaging Het
Ube4a A G 9: 44,949,727 probably null Het
Uggt2 A T 14: 118,998,104 I1453N probably damaging Het
Unc79 T C 12: 103,092,054 S972P probably damaging Het
Wdr20 G A 12: 110,738,215 D63N probably benign Het
Wdr66 T C 5: 123,254,424 V207A unknown Het
Wls T A 3: 159,873,179 I126N probably benign Het
Xirp2 A G 2: 67,524,945 D3350G probably benign Het
Other mutations in Nynrin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Nynrin APN 14 55868448 missense probably benign 0.38
IGL01131:Nynrin APN 14 55872685 missense probably damaging 1.00
IGL01357:Nynrin APN 14 55870417 missense probably benign
IGL01537:Nynrin APN 14 55872045 missense possibly damaging 0.87
IGL01583:Nynrin APN 14 55870511 missense probably damaging 1.00
IGL01726:Nynrin APN 14 55864154 missense probably benign
IGL02161:Nynrin APN 14 55863984 missense probably damaging 1.00
IGL02167:Nynrin APN 14 55863335 missense probably damaging 1.00
IGL02247:Nynrin APN 14 55871710 nonsense probably null
IGL02302:Nynrin APN 14 55868505 missense probably benign 0.43
IGL02524:Nynrin APN 14 55871474 missense possibly damaging 0.73
IGL02600:Nynrin APN 14 55863992 missense probably benign 0.38
IGL02639:Nynrin APN 14 55870655 missense probably damaging 1.00
IGL02654:Nynrin APN 14 55863259 missense possibly damaging 0.95
IGL02659:Nynrin APN 14 55866097 unclassified probably benign
IGL02736:Nynrin APN 14 55870909 missense probably damaging 1.00
IGL02949:Nynrin APN 14 55872380 missense probably damaging 0.99
PIT4458001:Nynrin UTSW 14 55863968 missense probably benign 0.39
R0017:Nynrin UTSW 14 55872395 missense probably damaging 1.00
R0078:Nynrin UTSW 14 55863332 missense probably damaging 1.00
R0211:Nynrin UTSW 14 55871798 missense probably benign 0.08
R0211:Nynrin UTSW 14 55871798 missense probably benign 0.08
R0413:Nynrin UTSW 14 55872191 missense possibly damaging 0.90
R0609:Nynrin UTSW 14 55872761 missense probably damaging 1.00
R0626:Nynrin UTSW 14 55868035 missense probably damaging 1.00
R1205:Nynrin UTSW 14 55854189 intron probably benign
R1222:Nynrin UTSW 14 55863541 missense probably benign 0.02
R1385:Nynrin UTSW 14 55864899 missense probably benign 0.00
R1820:Nynrin UTSW 14 55870378 missense possibly damaging 0.95
R1829:Nynrin UTSW 14 55872947 missense possibly damaging 0.50
R1874:Nynrin UTSW 14 55863493 missense probably benign 0.04
R1927:Nynrin UTSW 14 55863592 missense probably benign 0.00
R2233:Nynrin UTSW 14 55872067 missense possibly damaging 0.83
R3018:Nynrin UTSW 14 55863410 missense probably benign 0.00
R3154:Nynrin UTSW 14 55863587 missense possibly damaging 0.46
R3853:Nynrin UTSW 14 55864105 missense probably benign 0.24
R4648:Nynrin UTSW 14 55872894 nonsense probably null
R4722:Nynrin UTSW 14 55854395 missense probably damaging 0.97
R4735:Nynrin UTSW 14 55870168 missense probably benign 0.03
R4736:Nynrin UTSW 14 55863997 missense probably damaging 1.00
R4780:Nynrin UTSW 14 55863263 missense probably damaging 1.00
R4804:Nynrin UTSW 14 55864869 missense probably benign
R4816:Nynrin UTSW 14 55872001 missense probably damaging 1.00
R5307:Nynrin UTSW 14 55863806 missense probably damaging 1.00
R5372:Nynrin UTSW 14 55868491 missense probably benign 0.01
R5432:Nynrin UTSW 14 55864466 missense possibly damaging 0.80
R5800:Nynrin UTSW 14 55870631 missense probably damaging 1.00
R5825:Nynrin UTSW 14 55864226 missense probably benign 0.00
R6149:Nynrin UTSW 14 55854323 missense possibly damaging 0.83
R6244:Nynrin UTSW 14 55868028 missense probably damaging 1.00
R6350:Nynrin UTSW 14 55868076 missense probably benign 0.19
R6379:Nynrin UTSW 14 55870391 missense probably damaging 1.00
R6437:Nynrin UTSW 14 55871770 missense probably benign 0.00
R6501:Nynrin UTSW 14 55863532 missense probably benign
R6702:Nynrin UTSW 14 55864478 missense possibly damaging 0.80
R6703:Nynrin UTSW 14 55864478 missense possibly damaging 0.80
R6907:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6908:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6928:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6934:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6935:Nynrin UTSW 14 55863878 missense probably benign 0.20
R7197:Nynrin UTSW 14 55871923 missense probably benign 0.00
R7204:Nynrin UTSW 14 55872733 missense probably damaging 1.00
R7272:Nynrin UTSW 14 55870415 missense probably damaging 1.00
R7335:Nynrin UTSW 14 55863914 missense probably benign
R7361:Nynrin UTSW 14 55870400 missense possibly damaging 0.71
R7368:Nynrin UTSW 14 55870511 missense probably damaging 1.00
R7443:Nynrin UTSW 14 55871416 missense probably benign 0.18
R7584:Nynrin UTSW 14 55871584 missense probably damaging 1.00
R7677:Nynrin UTSW 14 55870236 missense probably benign
R7723:Nynrin UTSW 14 55872045 missense possibly damaging 0.87
R7776:Nynrin UTSW 14 55865963 missense probably damaging 1.00
R7787:Nynrin UTSW 14 55870523 missense probably benign
R7852:Nynrin UTSW 14 55871429 missense probably damaging 0.96
R8040:Nynrin UTSW 14 55871525 missense probably benign 0.01
R8159:Nynrin UTSW 14 55863130 missense probably damaging 0.99
R8159:Nynrin UTSW 14 55865060 missense probably benign
R8258:Nynrin UTSW 14 55863358 missense possibly damaging 0.95
R8259:Nynrin UTSW 14 55863358 missense possibly damaging 0.95
R8343:Nynrin UTSW 14 55863791 missense probably benign
R8504:Nynrin UTSW 14 55870246 missense probably benign 0.01
RF007:Nynrin UTSW 14 55866201 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTGAAGGTCCAGGGAAAGCC -3'
(R):5'- TCTGTACGCACTACCTACCG -3'

Sequencing Primer
(F):5'- GTTTCCAGCCCAGTAGCAC -3'
(R):5'- TACCGTGCAGTAGCCATTCAG -3'
Posted On2019-12-20