Incidental Mutation 'R0355:Nudt15'
ID 29790
Institutional Source Beutler Lab
Gene Symbol Nudt15
Ensembl Gene ENSMUSG00000033405
Gene Name nudix (nucleoside diphosphate linked moiety X)-type motif 15
Synonyms A730068G11Rik, MTH2
MMRRC Submission 038561-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R0355 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 73518877-73548242 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73523384 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 89 (Y89C)
Ref Sequence ENSEMBL: ENSMUSP00000039537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022705] [ENSMUST00000043813] [ENSMUST00000162691]
AlphaFold Q8BG93
Predicted Effect probably benign
Transcript: ENSMUST00000022705
SMART Domains Protein: ENSMUSP00000022705
Gene: ENSMUSG00000022109

DomainStartEndE-ValueType
Pfam:Med4 63 206 7.8e-34 PFAM
low complexity region 259 270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000043813
AA Change: Y89C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039537
Gene: ENSMUSG00000033405
AA Change: Y89C

DomainStartEndE-ValueType
Pfam:NUDIX 11 142 1.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228141
Meta Mutation Damage Score 0.5415 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 90.2%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the Nudix hydrolase superfamily. Members of this superfamily catalyze the hydrolysis of nucleoside diphosphates, including substrates like 8-oxo-dGTP, which are a result of oxidative damage, and can induce base mispairing during DNA replication, causing transversions. The encoded enzyme is a negative regulator of thiopurine activation and toxicity. Mutations in this gene result in poor metabolism of thiopurines, and are associated with thiopurine-induced early leukopenia. Multiple pseudogenes of this gene have been identified. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T G 7: 120,423,798 I52M possibly damaging Het
Agbl5 G T 5: 30,891,991 probably null Het
Akt2 T C 7: 27,636,909 probably benign Het
Arl6ip5 T A 6: 97,232,417 S138T probably damaging Het
Atp9b A G 18: 80,909,585 probably benign Het
Ccdc144b A G 3: 36,046,905 probably benign Het
Ccdc171 A T 4: 83,635,682 N422Y probably damaging Het
Ccr5 C T 9: 124,124,914 P185S possibly damaging Het
Cep63 G T 9: 102,623,560 Q38K probably benign Het
Cgn T C 3: 94,774,932 S446G probably benign Het
Col16a1 T A 4: 130,058,413 probably benign Het
Csmd1 T A 8: 15,918,330 Q3099L probably damaging Het
Dcc G A 18: 71,575,208 T479I possibly damaging Het
Dclre1a A G 19: 56,546,635 probably null Het
Dlg1 T A 16: 31,684,174 C66* probably null Het
Dnah12 T A 14: 26,706,117 probably null Het
Dnajb9 T A 12: 44,207,204 H140L probably damaging Het
Dnase1 G A 16: 4,039,549 V237M probably damaging Het
Dscam C A 16: 96,654,905 E1274D probably benign Het
Epb41 T C 4: 132,000,261 H243R probably damaging Het
Evc T A 5: 37,316,312 probably benign Het
Fcgrt T A 7: 45,103,069 M1L unknown Het
Flii T C 11: 60,719,680 probably null Het
Gen1 A G 12: 11,248,354 probably benign Het
Gm10447 T C 11: 53,456,430 probably benign Het
Gm8674 A T 13: 49,901,939 noncoding transcript Het
Gpr137 G C 19: 6,939,123 D253E probably damaging Het
Grid2ip A T 5: 143,357,897 D116V probably benign Het
Grin2c A G 11: 115,260,728 probably benign Het
Havcr1 A G 11: 46,756,224 T162A possibly damaging Het
Hspa1l A T 17: 34,977,410 T142S probably benign Het
Ift140 T A 17: 25,048,435 Y602* probably null Het
Il18 T A 9: 50,579,275 probably benign Het
Ilf3 T C 9: 21,397,970 V474A probably damaging Het
Inppl1 T C 7: 101,827,457 Y771C probably damaging Het
Ints2 T C 11: 86,234,749 T542A probably benign Het
Ipo7 T C 7: 110,049,661 Y714H probably benign Het
Itgbl1 T A 14: 123,840,585 C162* probably null Het
Kcp T C 6: 29,496,927 H561R possibly damaging Het
Krt23 G T 11: 99,485,787 T181N probably benign Het
Lrrc40 A T 3: 158,040,471 D61V probably damaging Het
Lypd4 T A 7: 24,865,266 H149L probably benign Het
Map3k4 A G 17: 12,254,171 F953L probably damaging Het
Mctp1 C T 13: 76,824,863 P405S probably damaging Het
Mfsd2a G A 4: 122,951,839 T173I possibly damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Nell2 A G 15: 95,432,901 V213A probably benign Het
Nipsnap1 G A 11: 4,889,957 G226E probably damaging Het
Olfr1341 T A 4: 118,709,611 M68K probably benign Het
Olfr1353 T G 10: 78,970,433 S261R probably damaging Het
Olfr63 T A 17: 33,269,135 M137K probably damaging Het
Olfr978 T A 9: 39,994,163 S118T possibly damaging Het
Phf24 A C 4: 42,933,891 E91A probably damaging Het
Plbd1 T A 6: 136,641,167 N17I possibly damaging Het
Por C T 5: 135,732,584 S308L probably benign Het
Prmt8 T A 6: 127,711,874 K178* probably null Het
Rev3l A G 10: 39,817,286 N454S probably damaging Het
Rps6ka2 T C 17: 7,271,610 V309A probably benign Het
Slc15a5 A G 6: 138,018,114 probably benign Het
Slc30a6 G A 17: 74,423,203 V363I probably benign Het
Snf8 G A 11: 96,039,299 M42I probably benign Het
Stom T C 2: 35,325,359 I65V probably benign Het
Tacr3 C T 3: 134,932,228 T382I probably benign Het
Tenm3 A G 8: 48,228,975 V2540A probably damaging Het
Trabd A G 15: 89,085,613 T314A possibly damaging Het
Tyk2 T C 9: 21,114,190 probably null Het
Ube4a T C 9: 44,944,801 probably benign Het
Unc80 A G 1: 66,549,856 H1060R possibly damaging Het
Virma A T 4: 11,528,626 K1288* probably null Het
Vmn2r100 A C 17: 19,531,320 I542L probably benign Het
Vwde T C 6: 13,187,807 probably benign Het
Zfc3h1 T C 10: 115,409,113 I797T possibly damaging Het
Zfp74 C T 7: 29,954,041 probably benign Het
Zkscan7 T A 9: 122,888,807 L89Q probably damaging Het
Other mutations in Nudt15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01728:Nudt15 APN 14 73523296 critical splice donor site probably null
R1711:Nudt15 UTSW 14 73523336 missense probably benign
R1763:Nudt15 UTSW 14 73521647 missense probably benign 0.44
R2430:Nudt15 UTSW 14 73525302 unclassified probably benign
R3846:Nudt15 UTSW 14 73523471 missense probably benign 0.01
R8132:Nudt15 UTSW 14 73521659 missense probably benign 0.17
R9545:Nudt15 UTSW 14 73523478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAACACAGGAACTTTCGAGGTC -3'
(R):5'- AACTGCACCCTTGCTGCCTAAGTC -3'

Sequencing Primer
(F):5'- GGAACTTTCGAGGTCATAGACAC -3'
(R):5'- AAGCTCTTTGGGTCTTCAAATCAC -3'
Posted On 2013-04-24