Mutagenetix > Incidental Mutations

Incidental Mutation 'R0355:Grin2c'

29786

Institutional Source

Beutler Lab

Gene Symbol

Grin2c

Ensembl Gene

ENSMUSG00000020734

Gene Name

glutamate receptor, ionotropic, NMDA2C (epsilon 3)

Synonyms

NR2C, GluRepsilon3, NMDAR2C

MMRRC Submission

038561-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.310) question?

Stock #

R0355 (G1)

Quality Score

223

Status

Validated

Chromosome

Chromosomal Location

115249169-115267243 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 115260728 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000102164 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003351] [ENSMUST00000106554]

Predicted Effect

probably benign
Transcript: ENSMUST00000003351

SMART Domains

Protein: ENSMUSP00000003351
Gene: ENSMUSG00000020734

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	99	299	5.1e-12	PFAM
PBPe	440	796	1.11e-79	SMART
Lig_chan-Glu_bd	448	500	2.79e-18	SMART
transmembrane domain	816	835	N/A	INTRINSIC
Pfam:NMDAR2_C	837	924	6.8e-15	PFAM
low complexity region	941	975	N/A	INTRINSIC
low complexity region	1041	1058	N/A	INTRINSIC
low complexity region	1063	1076	N/A	INTRINSIC
low complexity region	1173	1182	N/A	INTRINSIC
low complexity region	1194	1203	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106554

SMART Domains

Protein: ENSMUSP00000102164
Gene: ENSMUSG00000020734

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	100	306	6.9e-10	PFAM
PBPe	440	796	1.11e-79	SMART
Lig_chan-Glu_bd	448	500	2.79e-18	SMART
transmembrane domain	816	835	N/A	INTRINSIC
Pfam:NMDAR2_C	837	926	1.1e-13	PFAM
low complexity region	941	975	N/A	INTRINSIC
low complexity region	1041	1058	N/A	INTRINSIC
low complexity region	1063	1076	N/A	INTRINSIC
low complexity region	1173	1182	N/A	INTRINSIC
low complexity region	1194	1203	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 95.3%
20x: 90.2%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptor, which is a subtype of ionotropic glutamate receptor. NMDA receptors are found in the central nervous system, are permeable to cations and have an important role in physiological processes such as learning, memory, and synaptic development. The receptor is a tetramer of different subunits (typically heterodimer of subunit 1 with one or more of subunits 2A-D), forming a channel that is permeable to calcium, potassium, and sodium, and whose properties are determined by subunit composition. Alterations in the subunit composition of the receptor are associated with pathophysiological conditions such as Parkinson's disease, Alzheimer's disease, depression, and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit deficits in motor coordination and reduced granule cell responses to N-methy-D-aspartate in brain slices. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	T	G	7: 120,423,798	I52M	possibly damaging	Het
Agbl5	G	T	5: 30,891,991		probably null	Het
Akt2	T	C	7: 27,636,909		probably benign	Het
Arl6ip5	T	A	6: 97,232,417	S138T	probably damaging	Het
Atp9b	A	G	18: 80,909,585		probably benign	Het
Ccdc144b	A	G	3: 36,046,905		probably benign	Het
Ccdc171	A	T	4: 83,635,682	N422Y	probably damaging	Het
Ccr5	C	T	9: 124,124,914	P185S	possibly damaging	Het
Cep63	G	T	9: 102,623,560	Q38K	probably benign	Het
Cgn	T	C	3: 94,774,932	S446G	probably benign	Het
Col16a1	T	A	4: 130,058,413		probably benign	Het
Csmd1	T	A	8: 15,918,330	Q3099L	probably damaging	Het
Dcc	G	A	18: 71,575,208	T479I	possibly damaging	Het
Dclre1a	A	G	19: 56,546,635		probably null	Het
Dlg1	T	A	16: 31,684,174	C66*	probably null	Het
Dnah12	T	A	14: 26,706,117		probably null	Het
Dnajb9	T	A	12: 44,207,204	H140L	probably damaging	Het
Dnase1	G	A	16: 4,039,549	V237M	probably damaging	Het
Dscam	C	A	16: 96,654,905	E1274D	probably benign	Het
Epb41	T	C	4: 132,000,261	H243R	probably damaging	Het
Evc	T	A	5: 37,316,312		probably benign	Het
Fcgrt	T	A	7: 45,103,069	M1L	unknown	Het
Flii	T	C	11: 60,719,680		probably null	Het
Gen1	A	G	12: 11,248,354		probably benign	Het
Gm10447	T	C	11: 53,456,430		probably benign	Het
Gm8674	A	T	13: 49,901,939		noncoding transcript	Het
Gpr137	G	C	19: 6,939,123	D253E	probably damaging	Het
Grid2ip	A	T	5: 143,357,897	D116V	probably benign	Het
Havcr1	A	G	11: 46,756,224	T162A	possibly damaging	Het
Hspa1l	A	T	17: 34,977,410	T142S	probably benign	Het
Ift140	T	A	17: 25,048,435	Y602*	probably null	Het
Il18	T	A	9: 50,579,275		probably benign	Het
Ilf3	T	C	9: 21,397,970	V474A	probably damaging	Het
Inppl1	T	C	7: 101,827,457	Y771C	probably damaging	Het
Ints2	T	C	11: 86,234,749	T542A	probably benign	Het
Ipo7	T	C	7: 110,049,661	Y714H	probably benign	Het
Itgbl1	T	A	14: 123,840,585	C162*	probably null	Het
Kcp	T	C	6: 29,496,927	H561R	possibly damaging	Het
Krt23	G	T	11: 99,485,787	T181N	probably benign	Het
Lrrc40	A	T	3: 158,040,471	D61V	probably damaging	Het
Lypd4	T	A	7: 24,865,266	H149L	probably benign	Het
Map3k4	A	G	17: 12,254,171	F953L	probably damaging	Het
Mctp1	C	T	13: 76,824,863	P405S	probably damaging	Het
Mfsd2a	G	A	4: 122,951,839	T173I	possibly damaging	Het
Mtus1	T	C	8: 41,082,928	T584A	probably benign	Het
Nell2	A	G	15: 95,432,901	V213A	probably benign	Het
Nipsnap1	G	A	11: 4,889,957	G226E	probably damaging	Het
Nudt15	T	C	14: 73,523,384	Y89C	probably damaging	Het
Olfr1341	T	A	4: 118,709,611	M68K	probably benign	Het
Olfr1353	T	G	10: 78,970,433	S261R	probably damaging	Het
Olfr63	T	A	17: 33,269,135	M137K	probably damaging	Het
Olfr978	T	A	9: 39,994,163	S118T	possibly damaging	Het
Phf24	A	C	4: 42,933,891	E91A	probably damaging	Het
Plbd1	T	A	6: 136,641,167	N17I	possibly damaging	Het
Por	C	T	5: 135,732,584	S308L	probably benign	Het
Prmt8	T	A	6: 127,711,874	K178*	probably null	Het
Rev3l	A	G	10: 39,817,286	N454S	probably damaging	Het
Rps6ka2	T	C	17: 7,271,610	V309A	probably benign	Het
Slc15a5	A	G	6: 138,018,114		probably benign	Het
Slc30a6	G	A	17: 74,423,203	V363I	probably benign	Het
Snf8	G	A	11: 96,039,299	M42I	probably benign	Het
Stom	T	C	2: 35,325,359	I65V	probably benign	Het
Tacr3	C	T	3: 134,932,228	T382I	probably benign	Het
Tenm3	A	G	8: 48,228,975	V2540A	probably damaging	Het
Trabd	A	G	15: 89,085,613	T314A	possibly damaging	Het
Tyk2	T	C	9: 21,114,190		probably null	Het
Ube4a	T	C	9: 44,944,801		probably benign	Het
Unc80	A	G	1: 66,549,856	H1060R	possibly damaging	Het
Virma	A	T	4: 11,528,626	K1288*	probably null	Het
Vmn2r100	A	C	17: 19,531,320	I542L	probably benign	Het
Vwde	T	C	6: 13,187,807		probably benign	Het
Zfc3h1	T	C	10: 115,409,113	I797T	possibly damaging	Het
Zfp74	C	T	7: 29,954,041		probably benign	Het
Zkscan7	T	A	9: 122,888,807	L89Q	probably damaging	Het

Other mutations in Grin2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01019:Grin2c	APN	11	115258110	missense	possibly damaging	0.94
IGL01306:Grin2c	APN	11	115256194	missense	probably benign	0.01
IGL01408:Grin2c	APN	11	115260882	missense	probably damaging	1.00
IGL01539:Grin2c	APN	11	115250106	missense	probably benign	0.32
IGL01931:Grin2c	APN	11	115253910	missense	probably damaging	1.00
IGL01964:Grin2c	APN	11	115253847	missense	probably damaging	1.00
IGL02796:Grin2c	APN	11	115250717	splice site	probably benign
IGL02956:Grin2c	APN	11	115257959	missense	possibly damaging	0.86
IGL03221:Grin2c	APN	11	115254044	splice site	probably benign
ANU23:Grin2c	UTSW	11	115256194	missense	probably benign	0.01
PIT4362001:Grin2c	UTSW	11	115249633	missense	probably benign
R0011:Grin2c	UTSW	11	115255750	missense	probably damaging	1.00
R0011:Grin2c	UTSW	11	115255750	missense	probably damaging	1.00
R0112:Grin2c	UTSW	11	115251134	missense	probably damaging	1.00
R0681:Grin2c	UTSW	11	115249653	missense	probably benign
R0791:Grin2c	UTSW	11	115250646	missense	probably damaging	1.00
R0792:Grin2c	UTSW	11	115250646	missense	probably damaging	1.00
R1512:Grin2c	UTSW	11	115253850	missense	probably damaging	1.00
R1572:Grin2c	UTSW	11	115256074	missense	possibly damaging	0.92
R1654:Grin2c	UTSW	11	115260853	missense	probably benign	0.21
R1803:Grin2c	UTSW	11	115260732	critical splice donor site	probably null
R1982:Grin2c	UTSW	11	115260905	missense	possibly damaging	0.96
R2050:Grin2c	UTSW	11	115257419	missense	possibly damaging	0.89
R2196:Grin2c	UTSW	11	115250666	missense	probably benign	0.34
R2442:Grin2c	UTSW	11	115251134	missense	probably damaging	1.00
R2509:Grin2c	UTSW	11	115251068	nonsense	probably null
R3440:Grin2c	UTSW	11	115250643	missense	probably damaging	1.00
R3965:Grin2c	UTSW	11	115260994	missense	probably damaging	1.00
R4618:Grin2c	UTSW	11	115252747	missense	probably damaging	1.00
R4735:Grin2c	UTSW	11	115249596	missense	possibly damaging	0.63
R4856:Grin2c	UTSW	11	115260790	missense	probably damaging	1.00
R4886:Grin2c	UTSW	11	115260790	missense	probably damaging	1.00
R5277:Grin2c	UTSW	11	115253813	missense	probably damaging	1.00
R5334:Grin2c	UTSW	11	115256055	missense	possibly damaging	0.76
R5553:Grin2c	UTSW	11	115252725	missense	probably null	0.96
R5711:Grin2c	UTSW	11	115250289	missense	probably benign	0.32
R5784:Grin2c	UTSW	11	115258295	missense	possibly damaging	0.94
R5849:Grin2c	UTSW	11	115260991	missense	probably benign
R6421:Grin2c	UTSW	11	115251130	missense	probably damaging	1.00
R6461:Grin2c	UTSW	11	115255696	missense	possibly damaging	0.96
R6658:Grin2c	UTSW	11	115258282	missense	possibly damaging	0.64
R7205:Grin2c	UTSW	11	115251050	missense	probably damaging	0.99
R7611:Grin2c	UTSW	11	115252685	missense	probably damaging	1.00
R7637:Grin2c	UTSW	11	115256259	splice site	probably null
R7751:Grin2c	UTSW	11	115253870	missense	probably damaging	1.00
R7847:Grin2c	UTSW	11	115260978	missense	possibly damaging	0.68
R7930:Grin2c	UTSW	11	115260978	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- CAAGAGTGTCTGTCTTCCTCATGCC -3'
(R):5'- GCAGCATCCTCACCCAAATCTGTG -3'

Sequencing Primer
(F):5'- AGGTAACTTTGCCAGCACTG -3'
(R):5'- ACCCAAATCTGTGGGCTCC -3'

Posted On

2013-04-24