Mutagenetix > Incidental Mutation

Incidental Mutation 'R0355:Gm8674'

29788

Institutional Source

Beutler Lab

Gene Symbol

Gm8674

Ensembl Gene

ENSMUSG00000093976

Gene Name

predicted gene 8674

Synonyms

MMRRC Submission

038561-MU

Accession Numbers

Genbank: XM_990959; MGI: 3645762

Essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R0355 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

49899119-49904597 bp(-) (GRCm38)

Type of Mutation

exon

DNA Base Change (assembly)

A to T at 49901939 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000179367

SMART Domains

Protein: ENSMUSP00000137219
Gene: ENSMUSG00000093976

Domain	Start	End	E-Value	Type
low complexity region	70	86	N/A	INTRINSIC
Pfam:FAM75	92	444	3.6e-27	PFAM

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 95.3%
20x: 90.2%

Validation Efficiency

100% (76/76)

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	T	G	7: 120,423,798	I52M	possibly damaging	Het
Agbl5	G	T	5: 30,891,991		probably null	Het
Akt2	T	C	7: 27,636,909		probably benign	Het
Arl6ip5	T	A	6: 97,232,417	S138T	probably damaging	Het
Atp9b	A	G	18: 80,909,585		probably benign	Het
Ccdc144b	A	G	3: 36,046,905		probably benign	Het
Ccdc171	A	T	4: 83,635,682	N422Y	probably damaging	Het
Ccr5	C	T	9: 124,124,914	P185S	possibly damaging	Het
Cep63	G	T	9: 102,623,560	Q38K	probably benign	Het
Cgn	T	C	3: 94,774,932	S446G	probably benign	Het
Col16a1	T	A	4: 130,058,413		probably benign	Het
Csmd1	T	A	8: 15,918,330	Q3099L	probably damaging	Het
Dcc	G	A	18: 71,575,208	T479I	possibly damaging	Het
Dclre1a	A	G	19: 56,546,635		probably null	Het
Dlg1	T	A	16: 31,684,174	C66*	probably null	Het
Dnah12	T	A	14: 26,706,117		probably null	Het
Dnajb9	T	A	12: 44,207,204	H140L	probably damaging	Het
Dnase1	G	A	16: 4,039,549	V237M	probably damaging	Het
Dscam	C	A	16: 96,654,905	E1274D	probably benign	Het
Epb41	T	C	4: 132,000,261	H243R	probably damaging	Het
Evc	T	A	5: 37,316,312		probably benign	Het
Fcgrt	T	A	7: 45,103,069	M1L	unknown	Het
Flii	T	C	11: 60,719,680		probably null	Het
Gen1	A	G	12: 11,248,354		probably benign	Het
Gm10447	T	C	11: 53,456,430		probably benign	Het
Gpr137	G	C	19: 6,939,123	D253E	probably damaging	Het
Grid2ip	A	T	5: 143,357,897	D116V	probably benign	Het
Grin2c	A	G	11: 115,260,728		probably benign	Het
Havcr1	A	G	11: 46,756,224	T162A	possibly damaging	Het
Hspa1l	A	T	17: 34,977,410	T142S	probably benign	Het
Ift140	T	A	17: 25,048,435	Y602*	probably null	Het
Il18	T	A	9: 50,579,275		probably benign	Het
Ilf3	T	C	9: 21,397,970	V474A	probably damaging	Het
Inppl1	T	C	7: 101,827,457	Y771C	probably damaging	Het
Ints2	T	C	11: 86,234,749	T542A	probably benign	Het
Ipo7	T	C	7: 110,049,661	Y714H	probably benign	Het
Itgbl1	T	A	14: 123,840,585	C162*	probably null	Het
Kcp	T	C	6: 29,496,927	H561R	possibly damaging	Het
Krt23	G	T	11: 99,485,787	T181N	probably benign	Het
Lrrc40	A	T	3: 158,040,471	D61V	probably damaging	Het
Lypd4	T	A	7: 24,865,266	H149L	probably benign	Het
Map3k4	A	G	17: 12,254,171	F953L	probably damaging	Het
Mctp1	C	T	13: 76,824,863	P405S	probably damaging	Het
Mfsd2a	G	A	4: 122,951,839	T173I	possibly damaging	Het
Mtus1	T	C	8: 41,082,928	T584A	probably benign	Het
Nell2	A	G	15: 95,432,901	V213A	probably benign	Het
Nipsnap1	G	A	11: 4,889,957	G226E	probably damaging	Het
Nudt15	T	C	14: 73,523,384	Y89C	probably damaging	Het
Olfr1341	T	A	4: 118,709,611	M68K	probably benign	Het
Olfr1353	T	G	10: 78,970,433	S261R	probably damaging	Het
Olfr63	T	A	17: 33,269,135	M137K	probably damaging	Het
Olfr978	T	A	9: 39,994,163	S118T	possibly damaging	Het
Phf24	A	C	4: 42,933,891	E91A	probably damaging	Het
Plbd1	T	A	6: 136,641,167	N17I	possibly damaging	Het
Por	C	T	5: 135,732,584	S308L	probably benign	Het
Prmt8	T	A	6: 127,711,874	K178*	probably null	Het
Rev3l	A	G	10: 39,817,286	N454S	probably damaging	Het
Rps6ka2	T	C	17: 7,271,610	V309A	probably benign	Het
Slc15a5	A	G	6: 138,018,114		probably benign	Het
Slc30a6	G	A	17: 74,423,203	V363I	probably benign	Het
Snf8	G	A	11: 96,039,299	M42I	probably benign	Het
Stom	T	C	2: 35,325,359	I65V	probably benign	Het
Tacr3	C	T	3: 134,932,228	T382I	probably benign	Het
Tenm3	A	G	8: 48,228,975	V2540A	probably damaging	Het
Trabd	A	G	15: 89,085,613	T314A	possibly damaging	Het
Tyk2	T	C	9: 21,114,190		probably null	Het
Ube4a	T	C	9: 44,944,801		probably benign	Het
Unc80	A	G	1: 66,549,856	H1060R	possibly damaging	Het
Virma	A	T	4: 11,528,626	K1288*	probably null	Het
Vmn2r100	A	C	17: 19,531,320	I542L	probably benign	Het
Vwde	T	C	6: 13,187,807		probably benign	Het
Zfc3h1	T	C	10: 115,409,113	I797T	possibly damaging	Het
Zfp74	C	T	7: 29,954,041		probably benign	Het
Zkscan7	T	A	9: 122,888,807	L89Q	probably damaging	Het

Other mutations in Gm8674

Allele	Source	Chr	Coord	Type	Predicted Effect
R0357:Gm8674	UTSW	13	49902113	exon	noncoding transcript
R0627:Gm8674	UTSW	13	49899715	exon	noncoding transcript
R0833:Gm8674	UTSW	13	49904575	exon	noncoding transcript
R1300:Gm8674	UTSW	13	49901722	exon	noncoding transcript
R1452:Gm8674	UTSW	13	49900517	exon	noncoding transcript
R1542:Gm8674	UTSW	13	49900003	exon	noncoding transcript
R1613:Gm8674	UTSW	13	49902438	intron	noncoding transcript
R1643:Gm8674	UTSW	13	49901358	exon	noncoding transcript
R1732:Gm8674	UTSW	13	49901926	exon	noncoding transcript
R1824:Gm8674	UTSW	13	49900808	exon	noncoding transcript
R1840:Gm8674	UTSW	13	49901765	exon	noncoding transcript
R1915:Gm8674	UTSW	13	49900853	exon	noncoding transcript
R1934:Gm8674	UTSW	13	49901435	exon	noncoding transcript
R2040:Gm8674	UTSW	13	49901669	exon	noncoding transcript
R2214:Gm8674	UTSW	13	49901360	exon	noncoding transcript
R2421:Gm8674	UTSW	13	49900663	exon	noncoding transcript
R3423:Gm8674	UTSW	13	49901756	exon	noncoding transcript
R3425:Gm8674	UTSW	13	49901756	exon	noncoding transcript
R3886:Gm8674	UTSW	13	49902163	splice site	noncoding transcript
R4083:Gm8674	UTSW	13	49901011	exon	noncoding transcript
R4343:Gm8674	UTSW	13	49899706	exon	noncoding transcript
R4570:Gm8674	UTSW	13	49902534	intron	noncoding transcript
R4936:Gm8674	UTSW	13	49900755	exon	noncoding transcript
R4967:Gm8674	UTSW	13	49901998	exon	noncoding transcript
R5065:Gm8674	UTSW	13	49902577	intron	noncoding transcript
R5067:Gm8674	UTSW	13	49899834	exon	noncoding transcript
R5120:Gm8674	UTSW	13	49901948	exon	noncoding transcript
R5208:Gm8674	UTSW	13	49901921	exon	noncoding transcript
R5268:Gm8674	UTSW	13	49901354	exon	noncoding transcript
R5471:Gm8674	UTSW	13	49900813	exon	noncoding transcript
R5773:Gm8674	UTSW	13	49901876	exon	noncoding transcript
R5809:Gm8674	UTSW	13	49901888	exon	noncoding transcript
R8162:Gm8674	UTSW	13	49900371	missense	noncoding transcript
R8239:Gm8674	UTSW	13	49900226	missense	noncoding transcript
Z1088:Gm8674	UTSW	13	49900794	exon	noncoding transcript
Z1088:Gm8674	UTSW	13	49901248	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- GGTGCCCTTTGAGAAATTCCCAGTG -3'
(R):5'- ACTGATCCTTTCTTGTGGCTGATGC -3'

Sequencing Primer
(F):5'- CCCAGTGGGAATGCTAATGTC -3'
(R):5'- GGGTCTCATACACAAGGAGTTTAGTC -3'

Posted On

2013-04-24