Incidental Mutation 'R3938:Erap1'
ID 307296
Institutional Source Beutler Lab
Gene Symbol Erap1
Ensembl Gene ENSMUSG00000021583
Gene Name endoplasmic reticulum aminopeptidase 1
Synonyms ERAAP, Arts1, PILSAP
MMRRC Submission 040825-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock # R3938 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 74639568-74693201 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74668028 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 92 (L92Q)
Ref Sequence ENSEMBL: ENSMUSP00000152076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169114] [ENSMUST00000222127]
AlphaFold Q9EQH2
Predicted Effect probably damaging
Transcript: ENSMUST00000169114
AA Change: L521Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133166
Gene: ENSMUSG00000021583
AA Change: L521Q

DomainStartEndE-ValueType
Pfam:Peptidase_M1 42 430 2.7e-135 PFAM
low complexity region 488 501 N/A INTRINSIC
Pfam:ERAP1_C 586 904 1.7e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221606
Predicted Effect probably damaging
Transcript: ENSMUST00000222127
AA Change: L92Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9478 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an aminopeptidase involved in trimming HLA class I-binding precursors so that they can be presented on MHC class I molecules. The encoded protein acts as a monomer or as a heterodimer with ERAP2. This protein may also be involved in blood pressure regulation by inactivation of angiotensin II. Three transcript variants encoding two different isoforms have been found for this gene.[provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a targeted mutation may exhibit extramedullary hematopoiesis of the spleen, thymus hyperplasia, or enlarged kidneys at older ages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,154,294 P1561L probably damaging Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
Arid4b A T 13: 14,186,928 N659I probably benign Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Bmp4 T C 14: 46,384,079 Y336C probably damaging Het
Ccdc30 G A 4: 119,352,673 T293I probably benign Het
Chd5 A T 4: 152,377,055 T1275S probably benign Het
Chtf8 A T 8: 106,885,905 M134K probably benign Het
Col11a2 A T 17: 34,039,625 probably benign Het
Cyp8b1 A G 9: 121,915,618 V216A probably benign Het
Dnah8 C T 17: 30,854,937 T4527M probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Exoc3l G T 8: 105,293,405 P296H probably damaging Het
Gm5294 A T 5: 138,820,968 N78Y probably damaging Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hrnr T A 3: 93,322,855 N133K probably benign Het
Itgax G T 7: 128,136,273 R504S possibly damaging Het
Itgb4 A G 11: 116,005,926 S1461G possibly damaging Het
Klkb1 G T 8: 45,282,801 T175K probably damaging Het
Lrrk2 A T 15: 91,712,780 D525V possibly damaging Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga1 G T 17: 29,857,622 Q59K probably damaging Het
Mpp4 A G 1: 59,124,683 V466A possibly damaging Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nemp1 T C 10: 127,695,473 L311P probably damaging Het
Nup205 A G 6: 35,219,742 R1138G probably damaging Het
Nup54 A G 5: 92,417,529 M443T probably damaging Het
Peak1 T C 9: 56,260,365 E93G probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Poll A G 19: 45,558,418 probably benign Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Pygm A T 19: 6,392,950 I556F probably benign Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rcor3 G T 1: 192,101,085 T361K possibly damaging Het
Robo4 A G 9: 37,402,017 probably benign Het
Rps15 T C 10: 80,293,839 V96A probably benign Het
Rrm2 T A 12: 24,709,432 N55K probably damaging Het
Shank2 T C 7: 144,128,375 Y382H probably benign Het
Slc25a10 G T 11: 120,491,993 E3* probably null Het
Slc7a8 T A 14: 54,735,841 E223V probably benign Het
Snx13 A G 12: 35,144,097 K880E probably benign Het
Spinkl T G 18: 44,168,149 M41L probably benign Het
Srp54a A C 12: 55,089,257 N19T probably benign Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Sytl1 G A 4: 133,255,624 Q359* probably null Het
Tlr6 A T 5: 64,953,595 F656L probably damaging Het
Tmem185a C T X: 70,462,186 probably null Het
Tmem45a2 C T 16: 57,039,035 D278N probably benign Het
Trav7-1 T C 14: 52,655,334 probably benign Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc21a A G 9: 119,950,816 probably benign Het
Usp9y C T Y: 1,313,741 M2188I probably damaging Het
Utrn C A 10: 12,750,030 probably null Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Zfp955b T A 17: 33,305,416 Y59F probably damaging Het
Other mutations in Erap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Erap1 APN 13 74673659 missense probably benign 0.17
IGL00661:Erap1 APN 13 74674789 unclassified probably benign
IGL00903:Erap1 APN 13 74673707 missense probably benign
IGL01095:Erap1 APN 13 74668094 missense probably benign 0.04
IGL01536:Erap1 APN 13 74662423 nonsense probably null
IGL01646:Erap1 APN 13 74666172 missense probably damaging 1.00
IGL01674:Erap1 APN 13 74664231 unclassified probably benign
IGL01795:Erap1 APN 13 74666090 splice site probably null
IGL01922:Erap1 APN 13 74662387 missense probably damaging 1.00
IGL01951:Erap1 APN 13 74675295 missense probably damaging 0.99
IGL02106:Erap1 APN 13 74646639 missense probably benign
IGL02369:Erap1 APN 13 74666526 missense probably benign 0.05
IGL02669:Erap1 APN 13 74675868 missense probably benign 0.13
IGL02866:Erap1 APN 13 74667999 missense probably damaging 0.96
IGL03093:Erap1 APN 13 74675280 missense probably benign 0.10
IGL03265:Erap1 APN 13 74664127 missense probably damaging 1.00
R0091:Erap1 UTSW 13 74668052 missense possibly damaging 0.88
R0456:Erap1 UTSW 13 74664220 missense probably benign 0.24
R0556:Erap1 UTSW 13 74660325 missense probably damaging 1.00
R0627:Erap1 UTSW 13 74675814 unclassified probably benign
R0825:Erap1 UTSW 13 74674614 unclassified probably benign
R1123:Erap1 UTSW 13 74673643 missense probably benign
R1530:Erap1 UTSW 13 74646543 missense probably benign 0.06
R1619:Erap1 UTSW 13 74671381 missense probably damaging 1.00
R1731:Erap1 UTSW 13 74666122 nonsense probably null
R1944:Erap1 UTSW 13 74646639 missense probably benign
R2016:Erap1 UTSW 13 74664151 missense probably damaging 1.00
R2022:Erap1 UTSW 13 74666508 missense probably benign 0.08
R2023:Erap1 UTSW 13 74666508 missense probably benign 0.08
R2045:Erap1 UTSW 13 74669450 missense probably benign 0.01
R2081:Erap1 UTSW 13 74675307 missense possibly damaging 0.67
R2187:Erap1 UTSW 13 74662405 missense probably damaging 0.98
R2198:Erap1 UTSW 13 74646687 missense probably damaging 0.97
R4052:Erap1 UTSW 13 74675340 missense probably benign 0.13
R4062:Erap1 UTSW 13 74663536 missense probably benign 0.02
R4128:Erap1 UTSW 13 74666196 missense probably damaging 1.00
R4247:Erap1 UTSW 13 74675295 missense probably damaging 0.99
R4562:Erap1 UTSW 13 74673659 missense probably benign 0.21
R4691:Erap1 UTSW 13 74673692 missense probably damaging 0.99
R4831:Erap1 UTSW 13 74690647 missense probably damaging 1.00
R4916:Erap1 UTSW 13 74646528 missense probably benign
R4983:Erap1 UTSW 13 74690710 missense probably benign 0.01
R5213:Erap1 UTSW 13 74671495 splice site probably null
R5229:Erap1 UTSW 13 74660375 missense possibly damaging 0.94
R5367:Erap1 UTSW 13 74646561 missense probably damaging 0.99
R5463:Erap1 UTSW 13 74646414 missense probably damaging 1.00
R5566:Erap1 UTSW 13 74662412 missense probably damaging 1.00
R5972:Erap1 UTSW 13 74662304 splice site probably null
R6112:Erap1 UTSW 13 74646279 missense probably benign 0.44
R6132:Erap1 UTSW 13 74660282 missense probably benign 0.00
R6180:Erap1 UTSW 13 74666226 missense possibly damaging 0.55
R6314:Erap1 UTSW 13 74674775 missense probably damaging 0.99
R6479:Erap1 UTSW 13 74663493 splice site probably null
R6919:Erap1 UTSW 13 74671433 missense probably benign 0.20
R7199:Erap1 UTSW 13 74666139 missense probably benign 0.10
R7283:Erap1 UTSW 13 74673784 splice site probably null
R7543:Erap1 UTSW 13 74674634 missense probably damaging 1.00
R8174:Erap1 UTSW 13 74646564 missense probably benign 0.09
R8217:Erap1 UTSW 13 74672818 missense probably benign 0.33
R8320:Erap1 UTSW 13 74666549 missense probably benign 0.02
R8799:Erap1 UTSW 13 74657636 missense probably benign 0.02
R9041:Erap1 UTSW 13 74674699 missense probably benign 0.02
R9232:Erap1 UTSW 13 74663518 missense probably benign 0.36
R9244:Erap1 UTSW 13 74673784 splice site probably null
X0067:Erap1 UTSW 13 74660372 missense probably damaging 1.00
Z1176:Erap1 UTSW 13 74657638 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCCAACTGTCAAGACAC -3'
(R):5'- TTCAGCTGAAGCAGTCAAGG -3'

Sequencing Primer
(F):5'- CCAACTGTCAAGACACAGAGGTTTG -3'
(R):5'- CTGAAGCAGTCAAGGGAAGG -3'
Posted On 2015-04-17