Incidental Mutation 'R4018:Scyl3'
ID312011
Institutional Source Beutler Lab
Gene Symbol Scyl3
Ensembl Gene ENSMUSG00000026584
Gene NameSCY1-like 3 (S. cerevisiae)
Synonyms1200016D23Rik, Pace1
MMRRC Submission 040848-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R4018 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location163929100-163955126 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 163936499 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 145 (T145A)
Ref Sequence ENSEMBL: ENSMUSP00000132109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027876] [ENSMUST00000159516] [ENSMUST00000161908] [ENSMUST00000162234] [ENSMUST00000170359]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027876
AA Change: T145A

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027876
Gene: ENSMUSG00000026584
AA Change: T145A

DomainStartEndE-ValueType
Pfam:Pkinase 32 245 1.9e-7 PFAM
low complexity region 525 541 N/A INTRINSIC
low complexity region 711 731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159516
Predicted Effect possibly damaging
Transcript: ENSMUST00000161908
AA Change: T145A

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125735
Gene: ENSMUSG00000026584
AA Change: T145A

DomainStartEndE-ValueType
Pfam:Pkinase 25 274 1.5e-8 PFAM
low complexity region 512 528 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162234
Predicted Effect possibly damaging
Transcript: ENSMUST00000170359
AA Change: T145A

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132109
Gene: ENSMUSG00000026584
AA Change: T145A

DomainStartEndE-ValueType
Pfam:Pkinase 25 274 1.5e-8 PFAM
low complexity region 512 528 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
Meta Mutation Damage Score 0.3453 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a kinase domain and four HEAT repeats. The encoded protein interacts with the C-terminal domain of ezrin, an ERM protein, and may play a role in cell adhesion and migration. Alternative splicing results in multiple transcript variants encoding multiple isoforms. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aga A G 8: 53,523,191 K319R probably benign Het
Brip1 G T 11: 86,138,851 T619K possibly damaging Het
Cd300ld2 G T 11: 115,012,504 probably benign Het
Cd300lg A G 11: 102,041,594 R2G probably damaging Het
Celsr2 C T 3: 108,394,965 V2616I possibly damaging Het
Edem3 C T 1: 151,804,826 probably benign Het
Endou T A 15: 97,718,937 K235M probably damaging Het
Gm5431 T A 11: 48,889,168 N309I probably damaging Het
Il4 T A 11: 53,613,979 probably benign Het
Iws1 C A 18: 32,070,152 S27* probably null Het
Kdm5d T C Y: 910,441 probably benign Het
Ldb3 T C 14: 34,552,171 probably benign Het
Llgl2 A G 11: 115,847,612 T284A probably benign Het
Maml1 A T 11: 50,265,784 N521K probably damaging Het
Mlxipl T C 5: 135,132,672 Y482H probably damaging Het
Notch2 G T 3: 98,104,565 C633F probably damaging Het
Oc90 T C 15: 65,887,608 D232G probably benign Het
Olfr1453 T C 19: 13,027,825 E168G probably benign Het
Polr2a T C 11: 69,735,059 Y1717C unknown Het
Prkca T A 11: 107,939,602 I221F probably damaging Het
Rab3c T A 13: 110,084,194 K144N probably damaging Het
Ryr2 T A 13: 11,918,414 N57I probably damaging Het
Sept4 G A 11: 87,585,121 R162Q probably damaging Het
Slc25a39 A T 11: 102,405,024 L127H probably damaging Het
Slc9a9 T C 9: 94,685,163 V95A probably benign Het
Tsc2 T C 17: 24,625,281 I279V probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r6 T C 3: 64,556,472 I314V probably benign Het
Wdr66 A G 5: 123,322,454 I1160V probably benign Het
Other mutations in Scyl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Scyl3 APN 1 163934769 nonsense probably null
IGL03410:Scyl3 APN 1 163944867 missense probably damaging 1.00
R0017:Scyl3 UTSW 1 163939969 missense possibly damaging 0.53
R0017:Scyl3 UTSW 1 163939969 missense possibly damaging 0.53
R1138:Scyl3 UTSW 1 163933665 missense possibly damaging 0.47
R1363:Scyl3 UTSW 1 163950690 missense probably benign 0.01
R1564:Scyl3 UTSW 1 163939984 critical splice donor site probably null
R1843:Scyl3 UTSW 1 163950675 missense probably benign
R1856:Scyl3 UTSW 1 163933696 splice site probably null
R3873:Scyl3 UTSW 1 163950637 missense probably benign 0.00
R4746:Scyl3 UTSW 1 163949251 missense probably damaging 1.00
R4940:Scyl3 UTSW 1 163934747 missense probably damaging 1.00
R5408:Scyl3 UTSW 1 163954676 splice site probably null
R6125:Scyl3 UTSW 1 163950576 missense probably benign
R6268:Scyl3 UTSW 1 163946217 nonsense probably null
R6374:Scyl3 UTSW 1 163949214 missense probably benign 0.12
R7397:Scyl3 UTSW 1 163950918 splice site probably null
R7489:Scyl3 UTSW 1 163949176 missense possibly damaging 0.94
R7529:Scyl3 UTSW 1 163943869 missense probably damaging 0.99
R7615:Scyl3 UTSW 1 163950338 splice site probably null
R8089:Scyl3 UTSW 1 163936427 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GATCACATTGCTCTGTCTGCAG -3'
(R):5'- TGAGCCTCACACTTCTTTGAG -3'

Sequencing Primer
(F):5'- ACATTGCTCTGTCTGCAGTAACTAG -3'
(R):5'- AGCCTCACACTTCTTTGAGGATTAAC -3'
Posted On2015-04-29