Mutagenetix > Incidental Mutations

Incidental Mutation 'R4018:Scyl3'

312011

Institutional Source

Beutler Lab

Gene Symbol

Scyl3

Ensembl Gene

ENSMUSG00000026584

Gene Name

SCY1-like 3 (S. cerevisiae)

Synonyms

1200016D23Rik, Pace1

MMRRC Submission

040848-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.228) question?

Stock #

R4018 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

163929100-163955126 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 163936499 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 145 (T145A)

Ref Sequence

ENSEMBL: ENSMUSP00000132109 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027876] [ENSMUST00000159516] [ENSMUST00000161908] [ENSMUST00000162234] [ENSMUST00000170359]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027876
AA Change: T145A

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000027876
Gene: ENSMUSG00000026584
AA Change: T145A

Domain	Start	End	E-Value	Type
Pfam:Pkinase	32	245	1.9e-7	PFAM
low complexity region	525	541	N/A	INTRINSIC
low complexity region	711	731	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159516

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161908
AA Change: T145A

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000125735
Gene: ENSMUSG00000026584
AA Change: T145A

Domain	Start	End	E-Value	Type
Pfam:Pkinase	25	274	1.5e-8	PFAM
low complexity region	512	528	N/A	INTRINSIC
low complexity region	698	718	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162234

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170359
AA Change: T145A

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000132109
Gene: ENSMUSG00000026584
AA Change: T145A

Domain	Start	End	E-Value	Type
Pfam:Pkinase	25	274	1.5e-8	PFAM
low complexity region	512	528	N/A	INTRINSIC
low complexity region	698	718	N/A	INTRINSIC

Meta Mutation Damage Score

0.3453

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 92.4%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a kinase domain and four HEAT repeats. The encoded protein interacts with the C-terminal domain of ezrin, an ERM protein, and may play a role in cell adhesion and migration. Alternative splicing results in multiple transcript variants encoding multiple isoforms. [provided by RefSeq, Jun 2012]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aga	A	G	8: 53,523,191	K319R	probably benign	Het
Brip1	G	T	11: 86,138,851	T619K	possibly damaging	Het
Cd300ld2	G	T	11: 115,012,504		probably benign	Het
Cd300lg	A	G	11: 102,041,594	R2G	probably damaging	Het
Celsr2	C	T	3: 108,394,965	V2616I	possibly damaging	Het
Edem3	C	T	1: 151,804,826		probably benign	Het
Endou	T	A	15: 97,718,937	K235M	probably damaging	Het
Gm5431	T	A	11: 48,889,168	N309I	probably damaging	Het
Il4	T	A	11: 53,613,979		probably benign	Het
Iws1	C	A	18: 32,070,152	S27*	probably null	Het
Kdm5d	T	C	Y: 910,441		probably benign	Het
Ldb3	T	C	14: 34,552,171		probably benign	Het
Llgl2	A	G	11: 115,847,612	T284A	probably benign	Het
Maml1	A	T	11: 50,265,784	N521K	probably damaging	Het
Mlxipl	T	C	5: 135,132,672	Y482H	probably damaging	Het
Notch2	G	T	3: 98,104,565	C633F	probably damaging	Het
Oc90	T	C	15: 65,887,608	D232G	probably benign	Het
Olfr1453	T	C	19: 13,027,825	E168G	probably benign	Het
Polr2a	T	C	11: 69,735,059	Y1717C	unknown	Het
Prkca	T	A	11: 107,939,602	I221F	probably damaging	Het
Rab3c	T	A	13: 110,084,194	K144N	probably damaging	Het
Ryr2	T	A	13: 11,918,414	N57I	probably damaging	Het
Sept4	G	A	11: 87,585,121	R162Q	probably damaging	Het
Slc25a39	A	T	11: 102,405,024	L127H	probably damaging	Het
Slc9a9	T	C	9: 94,685,163	V95A	probably benign	Het
Tsc2	T	C	17: 24,625,281	I279V	probably damaging	Het
Usp34	C	T	11: 23,489,033	P3532S	possibly damaging	Het
Vmn2r6	T	C	3: 64,556,472	I314V	probably benign	Het
Wdr66	A	G	5: 123,322,454	I1160V	probably benign	Het

Other mutations in Scyl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Scyl3	APN	1	163934769	nonsense	probably null
IGL03410:Scyl3	APN	1	163944867	missense	probably damaging	1.00
R0017:Scyl3	UTSW	1	163939969	missense	possibly damaging	0.53
R0017:Scyl3	UTSW	1	163939969	missense	possibly damaging	0.53
R1138:Scyl3	UTSW	1	163933665	missense	possibly damaging	0.47
R1363:Scyl3	UTSW	1	163950690	missense	probably benign	0.01
R1564:Scyl3	UTSW	1	163939984	critical splice donor site	probably null
R1843:Scyl3	UTSW	1	163950675	missense	probably benign
R1856:Scyl3	UTSW	1	163933696	splice site	probably null
R3873:Scyl3	UTSW	1	163950637	missense	probably benign	0.00
R4746:Scyl3	UTSW	1	163949251	missense	probably damaging	1.00
R4940:Scyl3	UTSW	1	163934747	missense	probably damaging	1.00
R5408:Scyl3	UTSW	1	163954676	splice site	probably null
R6125:Scyl3	UTSW	1	163950576	missense	probably benign
R6268:Scyl3	UTSW	1	163946217	nonsense	probably null
R6374:Scyl3	UTSW	1	163949214	missense	probably benign	0.12
R7397:Scyl3	UTSW	1	163950918	splice site	probably null
R7489:Scyl3	UTSW	1	163949176	missense	possibly damaging	0.94
R7529:Scyl3	UTSW	1	163943869	missense	probably damaging	0.99
R7615:Scyl3	UTSW	1	163950338	splice site	probably null
R8089:Scyl3	UTSW	1	163936427	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- GATCACATTGCTCTGTCTGCAG -3'
(R):5'- TGAGCCTCACACTTCTTTGAG -3'

Sequencing Primer
(F):5'- ACATTGCTCTGTCTGCAGTAACTAG -3'
(R):5'- AGCCTCACACTTCTTTGAGGATTAAC -3'

Posted On

2015-04-29