Incidental Mutation 'R4018:Kdm5d'
ID312042
Institutional Source Beutler Lab
Gene Symbol Kdm5d
Ensembl Gene ENSMUSG00000056673
Gene Namelysine (K)-specific demethylase 5D
SynonymsJarid1d, Smcy, HY
MMRRC Submission 040848-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R4018 (G1)
Quality Score222
Status Validated
ChromosomeY
Chromosomal Location897788-956786 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 910441 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055032] [ENSMUST00000186696] [ENSMUST00000186726] [ENSMUST00000189069]
Predicted Effect probably benign
Transcript: ENSMUST00000055032
SMART Domains Protein: ENSMUSP00000061095
Gene: ENSMUSG00000056673

DomainStartEndE-ValueType
JmjN 13 54 3.45e-23 SMART
ARID 76 165 4.84e-36 SMART
BRIGHT 80 170 4.48e-38 SMART
PHD 325 371 8.56e-13 SMART
JmjC 467 633 2.52e-63 SMART
Pfam:zf-C5HC2 706 758 5.2e-18 PFAM
Pfam:PLU-1 771 1096 1.4e-89 PFAM
low complexity region 1147 1156 N/A INTRINSIC
low complexity region 1164 1181 N/A INTRINSIC
PHD 1182 1243 2.54e-6 SMART
coiled coil region 1290 1318 N/A INTRINSIC
low complexity region 1340 1351 N/A INTRINSIC
low complexity region 1395 1406 N/A INTRINSIC
low complexity region 1453 1459 N/A INTRINSIC
low complexity region 1525 1541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186696
SMART Domains Protein: ENSMUSP00000140663
Gene: ENSMUSG00000056673

DomainStartEndE-ValueType
JmjN 13 54 3.45e-23 SMART
ARID 76 165 4.84e-36 SMART
BRIGHT 80 170 4.48e-38 SMART
PHD 325 371 8.56e-13 SMART
JmjC 467 633 2.52e-63 SMART
low complexity region 675 689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186726
SMART Domains Protein: ENSMUSP00000140462
Gene: ENSMUSG00000056673

DomainStartEndE-ValueType
JmjN 13 54 1.4e-25 SMART
ARID 76 165 3.8e-40 SMART
BRIGHT 80 170 2.3e-40 SMART
Blast:ARID 175 260 1e-41 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188910
Predicted Effect probably benign
Transcript: ENSMUST00000189069
SMART Domains Protein: ENSMUSP00000139636
Gene: ENSMUSG00000056673

DomainStartEndE-ValueType
JmjN 13 54 3.45e-23 SMART
ARID 76 165 4.84e-36 SMART
BRIGHT 80 170 4.48e-38 SMART
Blast:ARID 175 298 1e-46 BLAST
PHD 325 371 8.56e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189626
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing zinc finger domains. A short peptide derived from this protein is a minor histocompatibility antigen which can lead to graft rejection of male donor cells in a female recipient. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aga A G 8: 53,523,191 K319R probably benign Het
Brip1 G T 11: 86,138,851 T619K possibly damaging Het
Cd300ld2 G T 11: 115,012,504 probably benign Het
Cd300lg A G 11: 102,041,594 R2G probably damaging Het
Celsr2 C T 3: 108,394,965 V2616I possibly damaging Het
Edem3 C T 1: 151,804,826 probably benign Het
Endou T A 15: 97,718,937 K235M probably damaging Het
Gm5431 T A 11: 48,889,168 N309I probably damaging Het
Il4 T A 11: 53,613,979 probably benign Het
Iws1 C A 18: 32,070,152 S27* probably null Het
Ldb3 T C 14: 34,552,171 probably benign Het
Llgl2 A G 11: 115,847,612 T284A probably benign Het
Maml1 A T 11: 50,265,784 N521K probably damaging Het
Mlxipl T C 5: 135,132,672 Y482H probably damaging Het
Notch2 G T 3: 98,104,565 C633F probably damaging Het
Oc90 T C 15: 65,887,608 D232G probably benign Het
Olfr1453 T C 19: 13,027,825 E168G probably benign Het
Polr2a T C 11: 69,735,059 Y1717C unknown Het
Prkca T A 11: 107,939,602 I221F probably damaging Het
Rab3c T A 13: 110,084,194 K144N probably damaging Het
Ryr2 T A 13: 11,918,414 N57I probably damaging Het
Scyl3 A G 1: 163,936,499 T145A possibly damaging Het
Sept4 G A 11: 87,585,121 R162Q probably damaging Het
Slc25a39 A T 11: 102,405,024 L127H probably damaging Het
Slc9a9 T C 9: 94,685,163 V95A probably benign Het
Tsc2 T C 17: 24,625,281 I279V probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r6 T C 3: 64,556,472 I314V probably benign Het
Wdr66 A G 5: 123,322,454 I1160V probably benign Het
Other mutations in Kdm5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0013:Kdm5d UTSW Y 941715 missense probably benign 0.37
R0013:Kdm5d UTSW Y 941715 missense probably benign 0.37
R0426:Kdm5d UTSW Y 942437 splice site probably benign
R0486:Kdm5d UTSW Y 927107 missense probably damaging 1.00
R0620:Kdm5d UTSW Y 927330 missense probably damaging 0.98
R0781:Kdm5d UTSW Y 910539 missense probably damaging 1.00
R1015:Kdm5d UTSW Y 941687 missense possibly damaging 0.95
R1110:Kdm5d UTSW Y 910539 missense probably damaging 1.00
R1163:Kdm5d UTSW Y 898029 missense probably benign 0.18
R1203:Kdm5d UTSW Y 941011 missense probably damaging 1.00
R1238:Kdm5d UTSW Y 941282 missense probably damaging 1.00
R1723:Kdm5d UTSW Y 927753 missense probably damaging 1.00
R1842:Kdm5d UTSW Y 927798 missense probably damaging 1.00
R1885:Kdm5d UTSW Y 940781 splice site probably null
R2131:Kdm5d UTSW Y 941483 missense probably benign 0.02
R2571:Kdm5d UTSW Y 940932 missense probably benign 0.11
R2931:Kdm5d UTSW Y 942992 missense probably benign 0.18
R3123:Kdm5d UTSW Y 900558 missense possibly damaging 0.63
R3919:Kdm5d UTSW Y 939914 missense probably damaging 1.00
R4031:Kdm5d UTSW Y 916910 missense probably damaging 1.00
R4403:Kdm5d UTSW Y 899830 missense probably damaging 1.00
R4571:Kdm5d UTSW Y 927110 missense probably damaging 1.00
R4583:Kdm5d UTSW Y 914134 missense probably damaging 1.00
R4962:Kdm5d UTSW Y 940624 missense probably damaging 1.00
R5105:Kdm5d UTSW Y 941752 missense probably benign 0.00
R5249:Kdm5d UTSW Y 916692 missense probably damaging 1.00
R5367:Kdm5d UTSW Y 941645 missense probably benign 0.05
R5373:Kdm5d UTSW Y 927995 missense probably benign 0.09
R5374:Kdm5d UTSW Y 927995 missense probably benign 0.09
R5876:Kdm5d UTSW Y 900525 missense probably damaging 1.00
R5909:Kdm5d UTSW Y 941306 missense probably benign 0.01
R6014:Kdm5d UTSW Y 921528 missense probably benign 0.45
R6109:Kdm5d UTSW Y 921501 missense probably damaging 1.00
R6251:Kdm5d UTSW Y 921693 missense probably damaging 1.00
R6349:Kdm5d UTSW Y 916847 missense probably damaging 0.99
R6450:Kdm5d UTSW Y 927056 missense probably damaging 1.00
R6595:Kdm5d UTSW Y 939829 missense probably benign
R6628:Kdm5d UTSW Y 900525 missense probably damaging 1.00
R6745:Kdm5d UTSW Y 927112 missense probably benign 0.28
R6867:Kdm5d UTSW Y 927425 missense probably benign
R6963:Kdm5d UTSW Y 937975 missense probably benign 0.01
R7163:Kdm5d UTSW Y 899940 missense probably damaging 1.00
R7374:Kdm5d UTSW Y 941491 missense probably benign 0.41
R7483:Kdm5d UTSW Y 914044 missense possibly damaging 0.50
R7501:Kdm5d UTSW Y 941488 missense probably damaging 1.00
R7815:Kdm5d UTSW Y 940702 missense probably damaging 1.00
R7835:Kdm5d UTSW Y 900558 missense possibly damaging 0.63
R8057:Kdm5d UTSW Y 927355 missense possibly damaging 0.48
R8080:Kdm5d UTSW Y 910742 missense probably benign 0.01
R8130:Kdm5d UTSW Y 940658 missense possibly damaging 0.75
R8213:Kdm5d UTSW Y 941515 missense probably damaging 1.00
R8261:Kdm5d UTSW Y 936929 missense probably damaging 0.99
R8344:Kdm5d UTSW Y 942477 missense probably benign 0.05
R8348:Kdm5d UTSW Y 914056 missense probably benign 0.00
R8445:Kdm5d UTSW Y 916874 missense probably damaging 1.00
R8448:Kdm5d UTSW Y 914056 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTCACTGCATGCACTTAGTG -3'
(R):5'- TTGCAGGGCATGTCACTTC -3'

Sequencing Primer
(F):5'- GCTTGCTAGTTACTATATGGGTGAAG -3'
(R):5'- ATGTCACTTCTTCTTTATCTAGGAGG -3'
Posted On2015-04-29