Incidental Mutation 'R4131:C1d'
ID314684
Institutional Source Beutler Lab
Gene Symbol C1d
Ensembl Gene ENSMUSG00000000581
Gene NameC1D nuclear receptor co-repressor
SynonymsSUN-CoR, 1110036E10Rik
MMRRC Submission 040994-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.564) question?
Stock #R4131 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location17257579-17269176 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 17264054 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000594] [ENSMUST00000156784]
Predicted Effect probably benign
Transcript: ENSMUST00000000594
SMART Domains Protein: ENSMUSP00000000594
Gene: ENSMUSG00000000581

DomainStartEndE-ValueType
Pfam:Sas10_Utp3 12 96 4.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135568
Predicted Effect probably benign
Transcript: ENSMUST00000156784
SMART Domains Protein: ENSMUSP00000121134
Gene: ENSMUSG00000000581

DomainStartEndE-ValueType
Pfam:Sas10_Utp3 12 96 3.2e-23 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA binding and apoptosis-inducing protein and is localized in the nucleus. It is also a Rac3-interacting protein which acts as a corepressor for the thyroid hormone receptor. This protein is thought to regulate TRAX/Translin complex formation. Alternate splicing results in multiple transcript variants that encode the same protein. Multiple pseudogenes of this gene are found on chromosome 10.[provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A G 9: 99,620,618 D277G possibly damaging Het
Abca12 A G 1: 71,319,871 probably null Het
Adam12 C T 7: 133,912,924 V345I probably damaging Het
Arpp21 T A 9: 112,155,308 probably benign Het
Art3 A T 5: 92,392,562 M55L probably benign Het
Ces1c A G 8: 93,100,684 M484T probably damaging Het
Cisd3 T C 11: 97,688,431 V133A possibly damaging Het
Clpx A G 9: 65,316,655 I230V possibly damaging Het
Cmklr1 C A 5: 113,614,484 R152L probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Heca A G 10: 17,902,239 S537P probably damaging Het
Igha C A 12: 113,258,829 probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Klk1b3 T A 7: 44,201,687 N181K probably damaging Het
Klra2 T A 6: 131,228,217 R220S probably benign Het
Lama2 C T 10: 27,041,174 V2252I probably benign Het
Megf10 G A 18: 57,180,535 C17Y probably damaging Het
Nup35 G A 2: 80,656,099 probably benign Het
Olfr503 C G 7: 108,544,537 S2* probably null Het
Olfr884 T A 9: 38,047,874 Y217* probably null Het
Pdzd9 A T 7: 120,662,869 D123E possibly damaging Het
Phactr1 A T 13: 43,037,477 Q141L probably damaging Het
Prelid2 T G 18: 41,951,159 D6A possibly damaging Het
Psmd1 T C 1: 86,078,700 S263P probably damaging Het
Rassf6 C T 5: 90,609,787 D105N probably damaging Het
Ryr3 C T 2: 112,926,983 probably null Het
Sema4g T A 19: 44,998,919 F501L probably benign Het
Ssrp1 A G 2: 85,044,447 E537G probably null Het
Try4 T A 6: 41,305,401 Y218* probably null Het
Zbtb40 G T 4: 136,995,396 S790R probably benign Het
Other mutations in C1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4623:C1d UTSW 11 17262742 missense possibly damaging 0.70
R5022:C1d UTSW 11 17266674 missense probably benign
R5023:C1d UTSW 11 17266674 missense probably benign
R7575:C1d UTSW 11 17262694 missense probably damaging 0.96
R8390:C1d UTSW 11 17263993 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAACTTTCCTCTTGAATAACTAGG -3'
(R):5'- AGGTAGGAGAGAAATTTCCCCATCTC -3'

Sequencing Primer
(F):5'- GCGGTTTCTCTCTTACAGT -3'
(R):5'- TAGCCCTGGAGATGACT -3'
Posted On2015-05-14