Incidental Mutation 'R4131:Art3'
ID314669
Institutional Source Beutler Lab
Gene Symbol Art3
Ensembl Gene ENSMUSG00000034842
Gene NameADP-ribosyltransferase 3
Synonyms4930569O04Rik
MMRRC Submission 040994-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4131 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location92331827-92414628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92392562 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 55 (M55L)
Ref Sequence ENSEMBL: ENSMUSP00000113493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113083] [ENSMUST00000117108] [ENSMUST00000118106] [ENSMUST00000119587] [ENSMUST00000120193] [ENSMUST00000120416] [ENSMUST00000120781] [ENSMUST00000121096] [ENSMUST00000124509] [ENSMUST00000125462] [ENSMUST00000128246] [ENSMUST00000138687] [ENSMUST00000145072] [ENSMUST00000154245]
Predicted Effect probably benign
Transcript: ENSMUST00000113083
AA Change: M55L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108706
Gene: ENSMUSG00000034842
AA Change: M55L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 4.4e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117108
AA Change: M55L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113041
Gene: ENSMUSG00000034842
AA Change: M55L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 1.9e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118106
AA Change: M55L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000114083
Gene: ENSMUSG00000034842
AA Change: M55L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 9e-66 PFAM
low complexity region 298 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119587
AA Change: M55L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112648
Gene: ENSMUSG00000034842
AA Change: M55L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 4e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120193
AA Change: M55L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113074
Gene: ENSMUSG00000034842
AA Change: M55L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 8.4e-66 PFAM
low complexity region 298 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120416
AA Change: M55L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113493
Gene: ENSMUSG00000034842
AA Change: M55L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 3.1e-65 PFAM
low complexity region 298 309 N/A INTRINSIC
low complexity region 366 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120781
AA Change: M55L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113008
Gene: ENSMUSG00000034842
AA Change: M55L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 215 1.2e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121096
AA Change: M55L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113510
Gene: ENSMUSG00000034842
AA Change: M55L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 1.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124509
AA Change: M55L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119113
Gene: ENSMUSG00000034842
AA Change: M55L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 192 8.9e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125462
AA Change: M55L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117995
Gene: ENSMUSG00000034842
AA Change: M55L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 244 1.4e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126281
SMART Domains Protein: ENSMUSP00000116110
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
Pfam:ART 1 190 3e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128246
AA Change: M55L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121620
Gene: ENSMUSG00000034842
AA Change: M55L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 206 2e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129222
Predicted Effect probably benign
Transcript: ENSMUST00000138687
AA Change: M55L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118746
Gene: ENSMUSG00000034842
AA Change: M55L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 65 1.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145072
AA Change: M55L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116218
Gene: ENSMUSG00000034842
AA Change: M55L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 108 9.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154245
AA Change: M55L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119283
Gene: ENSMUSG00000034842
AA Change: M55L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 178 4.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138003
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an arginine-specific ADP-ribosyltransferase. The encoded protein catalyzes a reversible reaction which modifies proteins by the addition or removal of ADP-ribose to an arginine residue to regulate the function of the modified protein. An ADP-ribosyltransferase pseudogene is located on chromosome 11. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A G 9: 99,620,618 D277G possibly damaging Het
Abca12 A G 1: 71,319,871 probably null Het
Adam12 C T 7: 133,912,924 V345I probably damaging Het
Arpp21 T A 9: 112,155,308 probably benign Het
C1d C T 11: 17,264,054 probably benign Het
Ces1c A G 8: 93,100,684 M484T probably damaging Het
Cisd3 T C 11: 97,688,431 V133A possibly damaging Het
Clpx A G 9: 65,316,655 I230V possibly damaging Het
Cmklr1 C A 5: 113,614,484 R152L probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Heca A G 10: 17,902,239 S537P probably damaging Het
Igha C A 12: 113,258,829 probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Klk1b3 T A 7: 44,201,687 N181K probably damaging Het
Klra2 T A 6: 131,228,217 R220S probably benign Het
Lama2 C T 10: 27,041,174 V2252I probably benign Het
Megf10 G A 18: 57,180,535 C17Y probably damaging Het
Nup35 G A 2: 80,656,099 probably benign Het
Olfr503 C G 7: 108,544,537 S2* probably null Het
Olfr884 T A 9: 38,047,874 Y217* probably null Het
Pdzd9 A T 7: 120,662,869 D123E possibly damaging Het
Phactr1 A T 13: 43,037,477 Q141L probably damaging Het
Prelid2 T G 18: 41,951,159 D6A possibly damaging Het
Psmd1 T C 1: 86,078,700 S263P probably damaging Het
Rassf6 C T 5: 90,609,787 D105N probably damaging Het
Ryr3 C T 2: 112,926,983 probably null Het
Sema4g T A 19: 44,998,919 F501L probably benign Het
Ssrp1 A G 2: 85,044,447 E537G probably null Het
Try4 T A 6: 41,305,401 Y218* probably null Het
Zbtb40 G T 4: 136,995,396 S790R probably benign Het
Other mutations in Art3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01526:Art3 APN 5 92414340 missense probably damaging 0.99
IGL01674:Art3 APN 5 92403614 nonsense probably null
R0011:Art3 UTSW 5 92403612 missense probably damaging 0.99
R0011:Art3 UTSW 5 92403612 missense probably damaging 0.99
R1861:Art3 UTSW 5 92412235 intron probably benign
R4726:Art3 UTSW 5 92411143 missense probably benign 0.10
R4810:Art3 UTSW 5 92414249 missense possibly damaging 0.84
R4959:Art3 UTSW 5 92403619 missense probably damaging 1.00
R4973:Art3 UTSW 5 92403619 missense probably damaging 1.00
R5592:Art3 UTSW 5 92392820 missense probably damaging 1.00
R5678:Art3 UTSW 5 92392550 missense probably damaging 0.99
R5813:Art3 UTSW 5 92412241 utr 3 prime probably benign
R5924:Art3 UTSW 5 92412232 intron probably benign
R6480:Art3 UTSW 5 92392817 missense probably damaging 1.00
R7452:Art3 UTSW 5 92392680 missense probably damaging 1.00
R7549:Art3 UTSW 5 92403655 missense probably benign 0.01
R7772:Art3 UTSW 5 92403613 missense probably damaging 0.99
R7947:Art3 UTSW 5 92392500 missense possibly damaging 0.88
Z1177:Art3 UTSW 5 92412206 missense unknown
Predicted Primers PCR Primer
(F):5'- GAATTTGACCCGCACCTCTC -3'
(R):5'- AAGGAAGTCTGCTCTTGAGC -3'

Sequencing Primer
(F):5'- TGTGATCCATAATTAAAAGGGCACG -3'
(R):5'- TGAGCCTCATTCACGTAGGC -3'
Posted On2015-05-14