Mutagenetix > Incidental Mutations

Incidental Mutation 'R4131:Zbtb40'

314667

Institutional Source

Beutler Lab

Gene Symbol

Zbtb40

Ensembl Gene

ENSMUSG00000060862

Gene Name

zinc finger and BTB domain containing 40

Synonyms

MMRRC Submission

040994-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.178) question?

Stock #

R4131 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

136979732-137048801 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 136995396 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 790 (S790R)

Ref Sequence

ENSEMBL: ENSMUSP00000061899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049583]

Predicted Effect

probably benign
Transcript: ENSMUST00000049583
AA Change: S790R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000061899
Gene: ENSMUSG00000060862
AA Change: S790R

Domain	Start	End	E-Value	Type
low complexity region	8	14	N/A	INTRINSIC
BTB	24	117	3.39e-18	SMART
low complexity region	150	170	N/A	INTRINSIC
low complexity region	525	533	N/A	INTRINSIC
low complexity region	725	741	N/A	INTRINSIC
ZnF_C2H2	754	774	4.86e1	SMART
low complexity region	786	801	N/A	INTRINSIC
ZnF_C2H2	825	848	1.16e-1	SMART
ZnF_C2H2	854	876	1.1e-2	SMART
ZnF_C2H2	882	905	1.16e-1	SMART
ZnF_C2H2	911	933	1.2e-3	SMART
ZnF_C2H2	939	962	8.81e-2	SMART
ZnF_C2H2	969	992	7.05e-1	SMART
ZnF_C2H2	997	1019	1.47e-3	SMART
ZnF_C2H2	1025	1047	2.86e-1	SMART
ZnF_C2H2	1065	1088	6.67e-2	SMART
ZnF_C2H2	1094	1117	6.23e-2	SMART
ZnF_C2H2	1123	1146	1.53e-1	SMART
ZnF_C2H2	1154	1177	1.56e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000218160

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (32/32)

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A4gnt	A	G	9: 99,620,618	D277G	possibly damaging	Het
Abca12	A	G	1: 71,319,871		probably null	Het
Adam12	C	T	7: 133,912,924	V345I	probably damaging	Het
Arpp21	T	A	9: 112,155,308		probably benign	Het
Art3	A	T	5: 92,392,562	M55L	probably benign	Het
C1d	C	T	11: 17,264,054		probably benign	Het
Ces1c	A	G	8: 93,100,684	M484T	probably damaging	Het
Cisd3	T	C	11: 97,688,431	V133A	possibly damaging	Het
Clpx	A	G	9: 65,316,655	I230V	possibly damaging	Het
Cmklr1	C	A	5: 113,614,484	R152L	probably damaging	Het
Grm7	G	T	6: 110,646,348	V161F	probably damaging	Het
Heca	A	G	10: 17,902,239	S537P	probably damaging	Het
Igha	C	A	12: 113,258,829		probably benign	Het
Itgb2l	A	G	16: 96,437,389	L70P	probably damaging	Het
Klk1b3	T	A	7: 44,201,687	N181K	probably damaging	Het
Klra2	T	A	6: 131,228,217	R220S	probably benign	Het
Lama2	C	T	10: 27,041,174	V2252I	probably benign	Het
Megf10	G	A	18: 57,180,535	C17Y	probably damaging	Het
Nup35	G	A	2: 80,656,099		probably benign	Het
Olfr503	C	G	7: 108,544,537	S2*	probably null	Het
Olfr884	T	A	9: 38,047,874	Y217*	probably null	Het
Pdzd9	A	T	7: 120,662,869	D123E	possibly damaging	Het
Phactr1	A	T	13: 43,037,477	Q141L	probably damaging	Het
Prelid2	T	G	18: 41,951,159	D6A	possibly damaging	Het
Psmd1	T	C	1: 86,078,700	S263P	probably damaging	Het
Rassf6	C	T	5: 90,609,787	D105N	probably damaging	Het
Ryr3	C	T	2: 112,926,983		probably null	Het
Sema4g	T	A	19: 44,998,919	F501L	probably benign	Het
Ssrp1	A	G	2: 85,044,447	E537G	probably null	Het
Try4	T	A	6: 41,305,401	Y218*	probably null	Het

Other mutations in Zbtb40

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Zbtb40	APN	4	136987340	missense	probably damaging	0.99
IGL00573:Zbtb40	APN	4	137018078	missense	probably benign	0.00
IGL00774:Zbtb40	APN	4	136994524	missense	probably damaging	1.00
R0046:Zbtb40	UTSW	4	136987278	missense	probably damaging	1.00
R0046:Zbtb40	UTSW	4	136987278	missense	probably damaging	1.00
R0334:Zbtb40	UTSW	4	136986556	missense	probably damaging	1.00
R0393:Zbtb40	UTSW	4	137018531	missense	probably benign	0.09
R0482:Zbtb40	UTSW	4	136983228	missense	probably damaging	1.00
R1457:Zbtb40	UTSW	4	136984837	missense	possibly damaging	0.81
R1846:Zbtb40	UTSW	4	137007839	missense	probably benign	0.00
R2153:Zbtb40	UTSW	4	136991635	missense	probably damaging	1.00
R2206:Zbtb40	UTSW	4	137017285	nonsense	probably null
R2291:Zbtb40	UTSW	4	136985017	missense	possibly damaging	0.78
R2406:Zbtb40	UTSW	4	136998568	missense	probably benign	0.34
R3707:Zbtb40	UTSW	4	136999568	missense	probably damaging	1.00
R4243:Zbtb40	UTSW	4	137018549	missense	probably benign	0.00
R4424:Zbtb40	UTSW	4	136998694	missense	probably damaging	0.96
R4725:Zbtb40	UTSW	4	137018761	utr 5 prime	probably benign
R4784:Zbtb40	UTSW	4	137007097	missense	probably damaging	1.00
R4795:Zbtb40	UTSW	4	136998642	missense	probably benign	0.00
R4796:Zbtb40	UTSW	4	136998642	missense	probably benign	0.00
R4838:Zbtb40	UTSW	4	137001216	missense	probably benign	0.15
R4859:Zbtb40	UTSW	4	136988759	missense	probably damaging	0.98
R4883:Zbtb40	UTSW	4	137000930	missense	probably benign	0.09
R5001:Zbtb40	UTSW	4	136996150	missense	probably damaging	1.00
R5030:Zbtb40	UTSW	4	136997952	missense	probably benign	0.00
R5060:Zbtb40	UTSW	4	137001293	missense	possibly damaging	0.71
R5529:Zbtb40	UTSW	4	136983163	missense	possibly damaging	0.90
R5536:Zbtb40	UTSW	4	136987331	missense	probably damaging	1.00
R5589:Zbtb40	UTSW	4	136995283	missense	probably damaging	1.00
R6114:Zbtb40	UTSW	4	136988691	missense	probably damaging	1.00
R6393:Zbtb40	UTSW	4	136984866	missense	probably null
R7208:Zbtb40	UTSW	4	136999626	splice site	probably null
R7406:Zbtb40	UTSW	4	137000894	missense	probably benign	0.29
R7722:Zbtb40	UTSW	4	136991518	missense	probably damaging	0.98
R7803:Zbtb40	UTSW	4	137017327	missense	probably benign
R8292:Zbtb40	UTSW	4	136999567	missense	probably damaging	1.00
RF014:Zbtb40	UTSW	4	137017306	missense	probably benign	0.20
Z1176:Zbtb40	UTSW	4	136995463	missense	probably damaging	1.00
Z1177:Zbtb40	UTSW	4	137018024	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTAGTGCTGAAGACATCCGC -3'
(R):5'- AGACTGCCAGGCCAATGAAC -3'

Sequencing Primer
(F):5'- TGAAGACATCCGCACTCAGGG -3'
(R):5'- CTGCCAGGCCAATGAACAAAAGG -3'

Posted On

2015-05-14