Incidental Mutation 'R4131:Zbtb40'
ID314667
Institutional Source Beutler Lab
Gene Symbol Zbtb40
Ensembl Gene ENSMUSG00000060862
Gene Namezinc finger and BTB domain containing 40
Synonyms
MMRRC Submission 040994-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R4131 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location136979732-137048801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 136995396 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 790 (S790R)
Ref Sequence ENSEMBL: ENSMUSP00000061899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049583]
Predicted Effect probably benign
Transcript: ENSMUST00000049583
AA Change: S790R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000061899
Gene: ENSMUSG00000060862
AA Change: S790R

DomainStartEndE-ValueType
low complexity region 8 14 N/A INTRINSIC
BTB 24 117 3.39e-18 SMART
low complexity region 150 170 N/A INTRINSIC
low complexity region 525 533 N/A INTRINSIC
low complexity region 725 741 N/A INTRINSIC
ZnF_C2H2 754 774 4.86e1 SMART
low complexity region 786 801 N/A INTRINSIC
ZnF_C2H2 825 848 1.16e-1 SMART
ZnF_C2H2 854 876 1.1e-2 SMART
ZnF_C2H2 882 905 1.16e-1 SMART
ZnF_C2H2 911 933 1.2e-3 SMART
ZnF_C2H2 939 962 8.81e-2 SMART
ZnF_C2H2 969 992 7.05e-1 SMART
ZnF_C2H2 997 1019 1.47e-3 SMART
ZnF_C2H2 1025 1047 2.86e-1 SMART
ZnF_C2H2 1065 1088 6.67e-2 SMART
ZnF_C2H2 1094 1117 6.23e-2 SMART
ZnF_C2H2 1123 1146 1.53e-1 SMART
ZnF_C2H2 1154 1177 1.56e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218160
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A G 9: 99,620,618 D277G possibly damaging Het
Abca12 A G 1: 71,319,871 probably null Het
Adam12 C T 7: 133,912,924 V345I probably damaging Het
Arpp21 T A 9: 112,155,308 probably benign Het
Art3 A T 5: 92,392,562 M55L probably benign Het
C1d C T 11: 17,264,054 probably benign Het
Ces1c A G 8: 93,100,684 M484T probably damaging Het
Cisd3 T C 11: 97,688,431 V133A possibly damaging Het
Clpx A G 9: 65,316,655 I230V possibly damaging Het
Cmklr1 C A 5: 113,614,484 R152L probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Heca A G 10: 17,902,239 S537P probably damaging Het
Igha C A 12: 113,258,829 probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Klk1b3 T A 7: 44,201,687 N181K probably damaging Het
Klra2 T A 6: 131,228,217 R220S probably benign Het
Lama2 C T 10: 27,041,174 V2252I probably benign Het
Megf10 G A 18: 57,180,535 C17Y probably damaging Het
Nup35 G A 2: 80,656,099 probably benign Het
Olfr503 C G 7: 108,544,537 S2* probably null Het
Olfr884 T A 9: 38,047,874 Y217* probably null Het
Pdzd9 A T 7: 120,662,869 D123E possibly damaging Het
Phactr1 A T 13: 43,037,477 Q141L probably damaging Het
Prelid2 T G 18: 41,951,159 D6A possibly damaging Het
Psmd1 T C 1: 86,078,700 S263P probably damaging Het
Rassf6 C T 5: 90,609,787 D105N probably damaging Het
Ryr3 C T 2: 112,926,983 probably null Het
Sema4g T A 19: 44,998,919 F501L probably benign Het
Ssrp1 A G 2: 85,044,447 E537G probably null Het
Try4 T A 6: 41,305,401 Y218* probably null Het
Other mutations in Zbtb40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zbtb40 APN 4 136987340 missense probably damaging 0.99
IGL00573:Zbtb40 APN 4 137018078 missense probably benign 0.00
IGL00774:Zbtb40 APN 4 136994524 missense probably damaging 1.00
R0046:Zbtb40 UTSW 4 136987278 missense probably damaging 1.00
R0046:Zbtb40 UTSW 4 136987278 missense probably damaging 1.00
R0334:Zbtb40 UTSW 4 136986556 missense probably damaging 1.00
R0393:Zbtb40 UTSW 4 137018531 missense probably benign 0.09
R0482:Zbtb40 UTSW 4 136983228 missense probably damaging 1.00
R1457:Zbtb40 UTSW 4 136984837 missense possibly damaging 0.81
R1846:Zbtb40 UTSW 4 137007839 missense probably benign 0.00
R2153:Zbtb40 UTSW 4 136991635 missense probably damaging 1.00
R2206:Zbtb40 UTSW 4 137017285 nonsense probably null
R2291:Zbtb40 UTSW 4 136985017 missense possibly damaging 0.78
R2406:Zbtb40 UTSW 4 136998568 missense probably benign 0.34
R3707:Zbtb40 UTSW 4 136999568 missense probably damaging 1.00
R4243:Zbtb40 UTSW 4 137018549 missense probably benign 0.00
R4424:Zbtb40 UTSW 4 136998694 missense probably damaging 0.96
R4725:Zbtb40 UTSW 4 137018761 utr 5 prime probably benign
R4784:Zbtb40 UTSW 4 137007097 missense probably damaging 1.00
R4795:Zbtb40 UTSW 4 136998642 missense probably benign 0.00
R4796:Zbtb40 UTSW 4 136998642 missense probably benign 0.00
R4838:Zbtb40 UTSW 4 137001216 missense probably benign 0.15
R4859:Zbtb40 UTSW 4 136988759 missense probably damaging 0.98
R4883:Zbtb40 UTSW 4 137000930 missense probably benign 0.09
R5001:Zbtb40 UTSW 4 136996150 missense probably damaging 1.00
R5030:Zbtb40 UTSW 4 136997952 missense probably benign 0.00
R5060:Zbtb40 UTSW 4 137001293 missense possibly damaging 0.71
R5529:Zbtb40 UTSW 4 136983163 missense possibly damaging 0.90
R5536:Zbtb40 UTSW 4 136987331 missense probably damaging 1.00
R5589:Zbtb40 UTSW 4 136995283 missense probably damaging 1.00
R6114:Zbtb40 UTSW 4 136988691 missense probably damaging 1.00
R6393:Zbtb40 UTSW 4 136984866 missense probably null
R7208:Zbtb40 UTSW 4 136999626 splice site probably null
R7406:Zbtb40 UTSW 4 137000894 missense probably benign 0.29
R7722:Zbtb40 UTSW 4 136991518 missense probably damaging 0.98
R7803:Zbtb40 UTSW 4 137017327 missense probably benign
RF014:Zbtb40 UTSW 4 137017306 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- CTAGTGCTGAAGACATCCGC -3'
(R):5'- AGACTGCCAGGCCAATGAAC -3'

Sequencing Primer
(F):5'- TGAAGACATCCGCACTCAGGG -3'
(R):5'- CTGCCAGGCCAATGAACAAAAGG -3'
Posted On2015-05-14