Incidental Mutation 'R4131:Olfr884'
ID314678
Institutional Source Beutler Lab
Gene Symbol Olfr884
Ensembl Gene ENSMUSG00000095893
Gene Nameolfactory receptor 884
SynonymsMOR162-13, MOR162-9P, Olfr1550-ps1, MOR162-11P, MOR162-11P, GA_x6K02T2PVTD-31726544-31727473
MMRRC Submission 040994-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4131 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38046555-38050137 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 38047874 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 217 (Y217*)
Ref Sequence ENSEMBL: ENSMUSP00000138035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077732] [ENSMUST00000181088]
Predicted Effect probably null
Transcript: ENSMUST00000077732
AA Change: Y217*
SMART Domains Protein: ENSMUSP00000076912
Gene: ENSMUSG00000095893
AA Change: Y217*

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 8e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 300 1.5e-6 PFAM
Pfam:7tm_1 41 288 5.1e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000181088
AA Change: Y217*
SMART Domains Protein: ENSMUSP00000138035
Gene: ENSMUSG00000095893
AA Change: Y217*

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 35 300 1.5e-6 PFAM
Pfam:7tm_1 41 288 4.6e-30 PFAM
Pfam:7tm_4 138 281 3.9e-45 PFAM
Meta Mutation Damage Score 0.9575 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A G 9: 99,620,618 D277G possibly damaging Het
Abca12 A G 1: 71,319,871 probably null Het
Adam12 C T 7: 133,912,924 V345I probably damaging Het
Arpp21 T A 9: 112,155,308 probably benign Het
Art3 A T 5: 92,392,562 M55L probably benign Het
C1d C T 11: 17,264,054 probably benign Het
Ces1c A G 8: 93,100,684 M484T probably damaging Het
Cisd3 T C 11: 97,688,431 V133A possibly damaging Het
Clpx A G 9: 65,316,655 I230V possibly damaging Het
Cmklr1 C A 5: 113,614,484 R152L probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Heca A G 10: 17,902,239 S537P probably damaging Het
Igha C A 12: 113,258,829 probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Klk1b3 T A 7: 44,201,687 N181K probably damaging Het
Klra2 T A 6: 131,228,217 R220S probably benign Het
Lama2 C T 10: 27,041,174 V2252I probably benign Het
Megf10 G A 18: 57,180,535 C17Y probably damaging Het
Nup35 G A 2: 80,656,099 probably benign Het
Olfr503 C G 7: 108,544,537 S2* probably null Het
Pdzd9 A T 7: 120,662,869 D123E possibly damaging Het
Phactr1 A T 13: 43,037,477 Q141L probably damaging Het
Prelid2 T G 18: 41,951,159 D6A possibly damaging Het
Psmd1 T C 1: 86,078,700 S263P probably damaging Het
Rassf6 C T 5: 90,609,787 D105N probably damaging Het
Ryr3 C T 2: 112,926,983 probably null Het
Sema4g T A 19: 44,998,919 F501L probably benign Het
Ssrp1 A G 2: 85,044,447 E537G probably null Het
Try4 T A 6: 41,305,401 Y218* probably null Het
Zbtb40 G T 4: 136,995,396 S790R probably benign Het
Other mutations in Olfr884
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Olfr884 APN 9 38047740 missense probably damaging 1.00
IGL02612:Olfr884 APN 9 38047366 missense probably damaging 1.00
IGL02802:Olfr884 UTSW 9 38048049 missense probably damaging 0.99
R0015:Olfr884 UTSW 9 38047667 nonsense probably null
R0142:Olfr884 UTSW 9 38048110 missense probably benign 0.37
R0559:Olfr884 UTSW 9 38047827 missense probably benign 0.16
R0561:Olfr884 UTSW 9 38047827 missense probably benign 0.16
R0715:Olfr884 UTSW 9 38047827 missense probably benign 0.16
R0723:Olfr884 UTSW 9 38047827 missense probably benign 0.16
R0729:Olfr884 UTSW 9 38047827 missense probably benign 0.16
R1350:Olfr884 UTSW 9 38047815 missense probably benign 0.02
R1869:Olfr884 UTSW 9 38048202 unclassified probably null
R3917:Olfr884 UTSW 9 38047545 missense probably damaging 1.00
R4764:Olfr884 UTSW 9 38048140 missense probably benign
R5857:Olfr884 UTSW 9 38047753 missense probably benign 0.18
R5976:Olfr884 UTSW 9 38047701 missense possibly damaging 0.80
R6329:Olfr884 UTSW 9 38047825 missense probably benign 0.02
R7344:Olfr884 UTSW 9 38047957 missense probably benign
R8289:Olfr884 UTSW 9 38047704 missense probably benign 0.02
RF009:Olfr884 UTSW 9 38047747 missense probably damaging 1.00
X0052:Olfr884 UTSW 9 38047699 missense possibly damaging 0.53
Z1177:Olfr884 UTSW 9 38047815 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCATGCTGAGACTCACCTTC -3'
(R):5'- AGTGCAAGATGGACATCCTTATTC -3'

Sequencing Primer
(F):5'- CCTCCATCAATGAGATGGT -3'
(R):5'- AGGATTCAGCATTGGACCC -3'
Posted On2015-05-14