Incidental Mutation 'R4131:Sema4g'
ID314691
Institutional Source Beutler Lab
Gene Symbol Sema4g
Ensembl Gene ENSMUSG00000025207
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
Synonyms
MMRRC Submission 040994-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4131 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location44989101-45003397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44998919 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 501 (F501L)
Ref Sequence ENSEMBL: ENSMUSP00000137395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026225] [ENSMUST00000130549] [ENSMUST00000179305]
Predicted Effect probably benign
Transcript: ENSMUST00000026225
AA Change: F501L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026225
Gene: ENSMUSG00000025207
AA Change: F501L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Sema 56 487 2.38e-165 SMART
PSI 505 556 6.59e-13 SMART
IG 567 649 6.26e-5 SMART
low complexity region 650 666 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
low complexity region 701 708 N/A INTRINSIC
low complexity region 713 720 N/A INTRINSIC
low complexity region 734 751 N/A INTRINSIC
low complexity region 761 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130549
AA Change: F501L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138321
Gene: ENSMUSG00000025207
AA Change: F501L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Sema 56 487 2.38e-165 SMART
PSI 505 556 6.59e-13 SMART
IG 567 649 6.26e-5 SMART
low complexity region 650 666 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
low complexity region 701 708 N/A INTRINSIC
low complexity region 713 720 N/A INTRINSIC
low complexity region 734 751 N/A INTRINSIC
low complexity region 761 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179305
AA Change: F501L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137395
Gene: ENSMUSG00000025207
AA Change: F501L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Sema 56 487 2.38e-165 SMART
PSI 505 556 6.59e-13 SMART
IG 567 649 6.26e-5 SMART
low complexity region 650 666 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
low complexity region 701 708 N/A INTRINSIC
low complexity region 713 720 N/A INTRINSIC
low complexity region 734 751 N/A INTRINSIC
low complexity region 761 774 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Semaphorins are a large family of conserved secreted and membrane associated proteins which possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Based on sequence and structural similarities, semaphorins are put into eight classes: invertebrates contain classes 1 and 2, viruses have class V, and vertebrates contain classes 3-7. Semaphorins serve as axon guidance ligands via multimeric receptor complexes, some (if not all) containing plexin proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a targeted allele exhibit normal cerebellar morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A G 9: 99,620,618 D277G possibly damaging Het
Abca12 A G 1: 71,319,871 probably null Het
Adam12 C T 7: 133,912,924 V345I probably damaging Het
Arpp21 T A 9: 112,155,308 probably benign Het
Art3 A T 5: 92,392,562 M55L probably benign Het
C1d C T 11: 17,264,054 probably benign Het
Ces1c A G 8: 93,100,684 M484T probably damaging Het
Cisd3 T C 11: 97,688,431 V133A possibly damaging Het
Clpx A G 9: 65,316,655 I230V possibly damaging Het
Cmklr1 C A 5: 113,614,484 R152L probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Heca A G 10: 17,902,239 S537P probably damaging Het
Igha C A 12: 113,258,829 probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Klk1b3 T A 7: 44,201,687 N181K probably damaging Het
Klra2 T A 6: 131,228,217 R220S probably benign Het
Lama2 C T 10: 27,041,174 V2252I probably benign Het
Megf10 G A 18: 57,180,535 C17Y probably damaging Het
Nup35 G A 2: 80,656,099 probably benign Het
Olfr503 C G 7: 108,544,537 S2* probably null Het
Olfr884 T A 9: 38,047,874 Y217* probably null Het
Pdzd9 A T 7: 120,662,869 D123E possibly damaging Het
Phactr1 A T 13: 43,037,477 Q141L probably damaging Het
Prelid2 T G 18: 41,951,159 D6A possibly damaging Het
Psmd1 T C 1: 86,078,700 S263P probably damaging Het
Rassf6 C T 5: 90,609,787 D105N probably damaging Het
Ryr3 C T 2: 112,926,983 probably null Het
Ssrp1 A G 2: 85,044,447 E537G probably null Het
Try4 T A 6: 41,305,401 Y218* probably null Het
Zbtb40 G T 4: 136,995,396 S790R probably benign Het
Other mutations in Sema4g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01414:Sema4g APN 19 44997996 missense probably damaging 1.00
IGL01419:Sema4g APN 19 44997396 missense probably benign 0.00
IGL02033:Sema4g APN 19 44997415 missense probably damaging 1.00
IGL02092:Sema4g APN 19 44992639 critical splice donor site probably null
IGL02148:Sema4g APN 19 44996469 missense probably damaging 1.00
IGL02829:Sema4g APN 19 44992749 missense possibly damaging 0.95
IGL02837:Sema4g UTSW 19 44996711 missense probably damaging 0.96
R0550:Sema4g UTSW 19 44997665 missense probably benign
R0675:Sema4g UTSW 19 44997587 missense probably damaging 1.00
R1202:Sema4g UTSW 19 44998257 missense probably benign 0.31
R1346:Sema4g UTSW 19 44997652 missense possibly damaging 0.65
R1533:Sema4g UTSW 19 44992817 missense probably damaging 1.00
R1763:Sema4g UTSW 19 45001605 nonsense probably null
R1775:Sema4g UTSW 19 44999242 critical splice donor site probably null
R1803:Sema4g UTSW 19 44998020 missense probably benign 0.05
R1832:Sema4g UTSW 19 44999017 missense probably benign
R1909:Sema4g UTSW 19 44997622 missense probably damaging 0.96
R4035:Sema4g UTSW 19 45001414 missense probably damaging 0.99
R4611:Sema4g UTSW 19 45001612 missense probably damaging 1.00
R4951:Sema4g UTSW 19 44996571 splice site probably null
R5921:Sema4g UTSW 19 44998704 missense probably benign 0.04
R7573:Sema4g UTSW 19 44997571 missense probably damaging 0.96
R8099:Sema4g UTSW 19 44992528 missense probably damaging 1.00
R8169:Sema4g UTSW 19 44998971 missense probably damaging 1.00
X0011:Sema4g UTSW 19 44998869 splice site probably null
Z1177:Sema4g UTSW 19 44998047 missense probably benign 0.03
Z1177:Sema4g UTSW 19 45001881 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAAGTGTTCAGGGAGCCC -3'
(R):5'- GGCTCACCAACAATACCTTAGAGG -3'

Sequencing Primer
(F):5'- GGGAGCCCCAGTCTGTG -3'
(R):5'- CCAACAATACCTTAGAGGCTGGTG -3'
Posted On2015-05-14