Incidental Mutation 'R4260:Mettl7a1'
ID322629
Institutional Source Beutler Lab
Gene Symbol Mettl7a1
Ensembl Gene ENSMUSG00000054619
Gene Namemethyltransferase like 7A1
SynonymsMettl7a, 3300001H21Rik, 2210414H16Rik
MMRRC Submission 041073-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R4260 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location100304140-100328662 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100313070 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 141 (D141G)
Ref Sequence ENSEMBL: ENSMUSP00000155295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067752] [ENSMUST00000229217] [ENSMUST00000229574] [ENSMUST00000229588] [ENSMUST00000230018] [ENSMUST00000230472] [ENSMUST00000231166]
Predicted Effect probably benign
Transcript: ENSMUST00000067752
AA Change: D192G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000065271
Gene: ENSMUSG00000054619
AA Change: D192G

DomainStartEndE-ValueType
Pfam:Ubie_methyltran 31 195 7.7e-12 PFAM
Pfam:Methyltransf_23 47 221 7e-20 PFAM
Pfam:Methyltransf_31 68 223 1.5e-15 PFAM
Pfam:Methyltransf_18 71 176 1e-9 PFAM
Pfam:Methyltransf_25 74 168 4e-12 PFAM
Pfam:Methyltransf_12 75 170 8.6e-16 PFAM
Pfam:Methyltransf_11 75 172 6.6e-23 PFAM
Pfam:Methyltransf_8 117 197 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229217
AA Change: D141G

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000229574
Predicted Effect probably benign
Transcript: ENSMUST00000229588
Predicted Effect probably benign
Transcript: ENSMUST00000230018
Predicted Effect probably benign
Transcript: ENSMUST00000230472
AA Change: D174G

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000231166
Meta Mutation Damage Score 0.2687 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp2 G A 18: 80,137,527 S52L possibly damaging Het
Best3 A T 10: 117,024,226 M464L probably benign Het
Ccdc83 T G 7: 90,228,391 D281A possibly damaging Het
Ccnf G A 17: 24,226,767 P502S probably damaging Het
Cd109 T A 9: 78,636,463 S96R possibly damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cntnap5a G T 1: 116,446,595 A946S probably benign Het
Csnk2a2 A T 8: 95,457,399 D177E probably benign Het
Cyld T C 8: 88,741,391 S551P probably damaging Het
Degs1 A T 1: 182,279,241 I151N probably benign Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Eif2ak3 G A 6: 70,889,513 R597H probably damaging Het
Epg5 A T 18: 77,959,121 H585L possibly damaging Het
Epg5 G C 18: 78,015,699 W1889C probably damaging Het
Fam220a G C 5: 143,563,007 R58P possibly damaging Het
Gemin5 G A 11: 58,168,359 A32V probably damaging Het
Gm11189 A C 11: 53,200,876 noncoding transcript Het
Grb2 A G 11: 115,649,816 I85T probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Ide A C 19: 37,329,186 S63A unknown Het
Kel A T 6: 41,686,423 probably benign Het
Kifap3 C A 1: 163,862,028 T527K probably damaging Het
Klra10 A G 6: 130,272,681 W214R probably damaging Het
Luc7l3 A T 11: 94,296,050 probably benign Het
Mrpl4 A G 9: 21,007,692 E211G possibly damaging Het
Olfr1285 T A 2: 111,408,505 noncoding transcript Het
Olfr669 A C 7: 104,938,596 E23D probably damaging Het
Pbld2 T C 10: 63,024,407 probably benign Het
Plcg1 T C 2: 160,751,707 probably null Het
Ppcs A G 4: 119,421,909 F149L probably damaging Het
Ptpdc1 A G 13: 48,579,758 M802T probably benign Het
Ptprf A G 4: 118,226,083 F909S possibly damaging Het
Raph1 A T 1: 60,502,965 M330K possibly damaging Het
Rprd1a G A 18: 24,488,295 R276C possibly damaging Het
Scg3 A G 9: 75,651,697 Y406H probably damaging Het
Setdb1 G A 3: 95,327,497 S965F probably damaging Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Slc5a4b A G 10: 76,103,852 L150P probably damaging Het
Spata17 T A 1: 187,048,480 T357S possibly damaging Het
Zap70 T A 1: 36,779,108 probably benign Het
Zfp985 G A 4: 147,583,572 C299Y probably damaging Het
Other mutations in Mettl7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02820:Mettl7a1 APN 15 100305052 nonsense probably null
R0943:Mettl7a1 UTSW 15 100304958 missense probably benign 0.19
R2258:Mettl7a1 UTSW 15 100313168 missense probably benign 0.43
R2259:Mettl7a1 UTSW 15 100313168 missense probably benign 0.43
R4625:Mettl7a1 UTSW 15 100313058 missense probably damaging 1.00
R4932:Mettl7a1 UTSW 15 100305106 missense probably benign 0.26
R7802:Mettl7a1 UTSW 15 100305301 missense possibly damaging 0.80
R7839:Mettl7a1 UTSW 15 100305076 missense possibly damaging 0.65
R7922:Mettl7a1 UTSW 15 100305076 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TCTCAAAGTCAGCCTCCAGC -3'
(R):5'- TCTAAAACGGAAGCCTGGAAC -3'

Sequencing Primer
(F):5'- CCACTGGAATTTGAAACTTGAGGC -3'
(R):5'- AAGCCTGGAACCAGCTCG -3'
Posted On2015-06-20