Incidental Mutation 'R4260:Olfr1285'
ID322597
Institutional Source Beutler Lab
Gene Symbol Olfr1285
Ensembl Gene ENSMUSG00000062280
Gene Nameolfactory receptor 1285
SynonymsMOR248-17P, MOR248-25_p, GA_x6K02T2Q125-72459956-72460837
MMRRC Submission 041073-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4260 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111408376-111409331 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to A at 111408505 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000184954]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184954
AA Change: *44R
SMART Domains Protein: ENSMUSP00000144852
Gene: ENSMUSG00000096703
AA Change: *44R

DomainStartEndE-ValueType
Pfam:7tm_4 1 264 7.6e-38 PFAM
Pfam:7tm_1 5 251 7.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220153
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp2 G A 18: 80,137,527 S52L possibly damaging Het
Best3 A T 10: 117,024,226 M464L probably benign Het
Ccdc83 T G 7: 90,228,391 D281A possibly damaging Het
Ccnf G A 17: 24,226,767 P502S probably damaging Het
Cd109 T A 9: 78,636,463 S96R possibly damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cntnap5a G T 1: 116,446,595 A946S probably benign Het
Csnk2a2 A T 8: 95,457,399 D177E probably benign Het
Cyld T C 8: 88,741,391 S551P probably damaging Het
Degs1 A T 1: 182,279,241 I151N probably benign Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Eif2ak3 G A 6: 70,889,513 R597H probably damaging Het
Epg5 G C 18: 78,015,699 W1889C probably damaging Het
Epg5 A T 18: 77,959,121 H585L possibly damaging Het
Fam220a G C 5: 143,563,007 R58P possibly damaging Het
Gemin5 G A 11: 58,168,359 A32V probably damaging Het
Gm11189 A C 11: 53,200,876 noncoding transcript Het
Grb2 A G 11: 115,649,816 I85T probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Ide A C 19: 37,329,186 S63A unknown Het
Kel A T 6: 41,686,423 probably benign Het
Kifap3 C A 1: 163,862,028 T527K probably damaging Het
Klra10 A G 6: 130,272,681 W214R probably damaging Het
Luc7l3 A T 11: 94,296,050 probably benign Het
Mettl7a1 A G 15: 100,313,070 D141G probably benign Het
Mrpl4 A G 9: 21,007,692 E211G possibly damaging Het
Olfr669 A C 7: 104,938,596 E23D probably damaging Het
Pbld2 T C 10: 63,024,407 probably benign Het
Plcg1 T C 2: 160,751,707 probably null Het
Ppcs A G 4: 119,421,909 F149L probably damaging Het
Ptpdc1 A G 13: 48,579,758 M802T probably benign Het
Ptprf A G 4: 118,226,083 F909S possibly damaging Het
Raph1 A T 1: 60,502,965 M330K possibly damaging Het
Rprd1a G A 18: 24,488,295 R276C possibly damaging Het
Scg3 A G 9: 75,651,697 Y406H probably damaging Het
Setdb1 G A 3: 95,327,497 S965F probably damaging Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Slc5a4b A G 10: 76,103,852 L150P probably damaging Het
Spata17 T A 1: 187,048,480 T357S possibly damaging Het
Zap70 T A 1: 36,779,108 probably benign Het
Zfp985 G A 4: 147,583,572 C299Y probably damaging Het
Other mutations in Olfr1285
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Olfr1285 APN 2 111409219 missense probably damaging 1.00
IGL01819:Olfr1285 APN 2 111408733 missense probably damaging 0.99
IGL02109:Olfr1285 APN 2 111408493 exon noncoding transcript
IGL02407:Olfr1285 APN 2 111408578 exon noncoding transcript
R0054:Olfr1285 UTSW 2 111408795 missense probably benign 0.00
R1665:Olfr1285 UTSW 2 111408753 missense probably damaging 1.00
R2339:Olfr1285 UTSW 2 111409189 missense probably benign 0.36
R3876:Olfr1285 UTSW 2 111408622 missense possibly damaging 0.57
R4439:Olfr1285 UTSW 2 111409308 exon noncoding transcript
R4762:Olfr1285 UTSW 2 111408880 exon noncoding transcript
R4821:Olfr1285 UTSW 2 111409225 exon noncoding transcript
R5120:Olfr1285 UTSW 2 111409240 exon noncoding transcript
R5215:Olfr1285 UTSW 2 111409286 exon noncoding transcript
R5244:Olfr1285 UTSW 2 111408554 exon noncoding transcript
R5667:Olfr1285 UTSW 2 111408473 exon noncoding transcript
R5671:Olfr1285 UTSW 2 111408473 exon noncoding transcript
R5687:Olfr1285 UTSW 2 111408688 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GGGATGGATAAGTTGCTAAGATTTC -3'
(R):5'- AGAGGATCTGGCTCATGCAG -3'

Sequencing Primer
(F):5'- AGCTATTGTTTCTCTTGCAGAAC -3'
(R):5'- TGCAGCCCCCAAAGGAAATTG -3'
Posted On2015-06-20