Incidental Mutation 'R4276:Kctd6'
ID322708
Institutional Source Beutler Lab
Gene Symbol Kctd6
Ensembl Gene ENSMUSG00000021752
Gene Namepotassium channel tetramerisation domain containing 6
Synonyms5430433B02Rik
MMRRC Submission 041647-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R4276 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location8214140-8223563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 8222806 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 216 (R216P)
Ref Sequence ENSEMBL: ENSMUSP00000129059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022271] [ENSMUST00000022272] [ENSMUST00000164598] [ENSMUST00000170111]
Predicted Effect probably benign
Transcript: ENSMUST00000022271
SMART Domains Protein: ENSMUSP00000022271
Gene: ENSMUSG00000021751

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 32 148 1.2e-28 PFAM
SCOP:d1is2a1 309 478 1e-28 SMART
Pfam:ACOX 492 677 3.2e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000022272
AA Change: R216P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022272
Gene: ENSMUSG00000021752
AA Change: R216P

DomainStartEndE-ValueType
BTB 12 113 1.29e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164598
SMART Domains Protein: ENSMUSP00000126464
Gene: ENSMUSG00000021751

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 32 148 6.3e-29 PFAM
Pfam:Acyl-CoA_dh_M 150 260 2.8e-11 PFAM
SCOP:d1is2a1 309 478 1e-28 SMART
Pfam:ACOX 495 675 1.3e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170111
AA Change: R216P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129059
Gene: ENSMUSG00000021752
AA Change: R216P

DomainStartEndE-ValueType
BTB 12 113 1.29e-9 SMART
Meta Mutation Damage Score 0.2412 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 C A 9: 26,978,449 Q316H probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Brix1 T C 15: 10,481,747 D101G possibly damaging Het
Cfap36 A G 11: 29,230,584 probably null Het
Chrnb3 A G 8: 27,393,751 N172S probably damaging Het
Csnk1e T C 15: 79,429,767 N37S probably damaging Het
Ern1 T C 11: 106,407,181 I705V probably benign Het
Gimap8 T C 6: 48,659,083 M594T probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Gpc6 A G 14: 117,435,916 D195G probably damaging Het
Gpcpd1 T C 2: 132,540,287 K412E probably damaging Het
Insm1 C A 2: 146,222,968 H235N probably benign Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Kbtbd8 T C 6: 95,126,933 V521A probably damaging Het
Kcna5 T C 6: 126,533,366 T600A probably damaging Het
Lbx1 C A 19: 45,235,089 V47L probably benign Het
Mefv A T 16: 3,715,569 N279K probably benign Het
Mroh1 T G 15: 76,393,851 V24G probably damaging Het
Nt5c1b A G 12: 10,374,886 E142G probably damaging Het
Olfr1038-ps G A 2: 86,122,279 A119T probably damaging Het
Olfr1289 G T 2: 111,483,504 V25L probably damaging Het
Padi2 A G 4: 140,936,548 E404G possibly damaging Het
Pitpnb A G 5: 111,371,392 probably null Het
Plxna4 T C 6: 32,200,948 N1006S probably benign Het
Proc A G 18: 32,135,914 V6A probably benign Het
Prrc2c T A 1: 162,673,591 K1214N probably damaging Het
Pstpip2 A G 18: 77,861,856 I122V probably benign Het
Pus10 A G 11: 23,706,895 E207G probably damaging Het
Rabl2 G A 15: 89,584,188 probably benign Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rtl6 T A 15: 84,557,196 probably benign Het
Scn7a T G 2: 66,684,063 K1122N probably damaging Het
Spag16 A G 1: 69,873,481 probably benign Het
Spata13 C T 14: 60,756,296 R396C probably damaging Het
Stmn4 A T 14: 66,355,717 probably benign Het
Syp G T X: 7,638,692 probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Tnrc6b A G 15: 80,901,971 I1239V probably benign Het
Ubr3 C T 2: 69,938,387 Q510* probably null Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn2r93 T C 17: 18,304,830 I250T possibly damaging Het
Other mutations in Kctd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Kctd6 APN 14 8222856 missense possibly damaging 0.58
IGL01121:Kctd6 APN 14 8222656 missense possibly damaging 0.92
R1735:Kctd6 UTSW 14 8222253 missense probably damaging 1.00
R2100:Kctd6 UTSW 14 8222239 missense possibly damaging 0.90
R2167:Kctd6 UTSW 14 8222683 missense probably benign
R4278:Kctd6 UTSW 14 8222806 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGGTCCACTCCTTACTCGAAG -3'
(R):5'- ACACAAAACTTCCTTCTGGTCC -3'

Sequencing Primer
(F):5'- GCATCTCAAACTATTTCACCAAGTGG -3'
(R):5'- TGAGCTTGCAGGAAGTTC -3'
Posted On2015-06-20