Incidental Mutation 'R4766:Kcna4'
ID366119
Institutional Source Beutler Lab
Gene Symbol Kcna4
Ensembl Gene ENSMUSG00000042604
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 4
SynonymsKv1.4
MMRRC Submission 042407-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4766 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location107290639-107298502 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 107296543 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 541 (V541M)
Ref Sequence ENSEMBL: ENSMUSP00000037958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037012]
Predicted Effect probably damaging
Transcript: ENSMUST00000037012
AA Change: V541M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037958
Gene: ENSMUSG00000042604
AA Change: V541M

DomainStartEndE-ValueType
Pfam:K_channel_TID 1 74 1.5e-42 PFAM
low complexity region 77 89 N/A INTRINSIC
coiled coil region 112 139 N/A INTRINSIC
low complexity region 160 166 N/A INTRINSIC
BTB 177 277 1.67e-8 SMART
Pfam:Ion_trans 307 572 2.8e-51 PFAM
Pfam:Ion_trans_2 480 565 9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173191
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the A-type potassium current class, the members of which may be important in the regulation of the fast repolarizing phase of action potentials in heart and thus may influence the duration of cardiac action potential.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal; however, a small subset of mutants exhibit spontaneous seizure activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,097,636 V1584I probably benign Het
A430105I19Rik C A 2: 118,759,577 R262L probably damaging Het
Adamts12 A G 15: 11,285,901 D732G probably benign Het
Agpat4 A G 17: 12,151,750 probably benign Het
AI182371 T C 2: 35,095,817 D140G possibly damaging Het
Apol11b T A 15: 77,634,933 T316S probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bard1 T C 1: 71,075,174 E216G probably benign Het
Bdp1 C A 13: 100,049,868 R1692L probably damaging Het
Capn10 T C 1: 92,943,419 I101T probably damaging Het
Ccdc175 C T 12: 72,112,205 M653I probably benign Het
Ccr8 G A 9: 120,094,464 C215Y probably damaging Het
Cct3 T A 3: 88,311,785 L241* probably null Het
Cd2ap A T 17: 42,852,459 I25N probably damaging Het
Cdh19 T C 1: 110,893,260 K583E probably benign Het
Cela3a A G 4: 137,402,675 S212P unknown Het
Cfap44 T A 16: 44,415,883 probably null Het
Clca3a1 A T 3: 144,749,712 L440Q probably damaging Het
Crybg2 A G 4: 134,089,352 Y1676C probably damaging Het
Dscam T C 16: 96,643,988 D1501G probably benign Het
Eml6 C A 11: 29,805,757 L832F probably benign Het
Enpp3 A G 10: 24,773,927 L867P probably damaging Het
Erbb3 A G 10: 128,586,238 Y46H possibly damaging Het
Fads3 T C 19: 10,056,020 I342T possibly damaging Het
Flvcr1 A T 1: 191,021,106 S290T probably benign Het
Fut9 A G 4: 25,799,191 probably benign Het
Gad2 C T 2: 22,622,667 A2V probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Herc1 T G 9: 66,441,929 D2023E probably benign Het
Hsd3b3 A G 3: 98,742,485 L174P probably damaging Het
Impg2 TACCACCACCACCACCACCACCACCA TACCACCACCACCACCACCACCA 16: 56,257,939 probably benign Het
Iqcf3 A G 9: 106,560,949 probably null Het
Kcnj11 T C 7: 46,099,816 T28A probably benign Het
Kcnmb2 T A 3: 32,181,867 N88K probably damaging Het
Kdm2a TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCTTCCTCCTCCTC 19: 4,324,507 probably benign Het
Krt2 T C 15: 101,813,960 E430G probably damaging Het
Lins1 C T 7: 66,710,641 L384F possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mfge8 T C 7: 79,134,525 N389D probably damaging Het
Mug1 C T 6: 121,884,254 T1278I probably benign Het
Myh9 T C 15: 77,807,877 M161V probably damaging Het
Myl7 T A 11: 5,898,171 Y61F probably benign Het
Nlrp4d A T 7: 10,362,779 unknown Het
Nol3 A G 8: 105,281,933 probably null Het
Nup85 T A 11: 115,577,925 probably null Het
Obscn T A 11: 59,012,742 T7619S probably damaging Het
Olfr1298 T C 2: 111,645,881 M39V probably benign Het
Olfr331 T A 11: 58,501,668 N296I probably damaging Het
Olfr628 C T 7: 103,732,250 T108I possibly damaging Het
Olfr844 G A 9: 19,318,845 V104I probably benign Het
Pax5 T A 4: 44,679,494 I184F probably damaging Het
Pcdha7 T A 18: 36,974,507 V195D probably damaging Het
Phf3 A T 1: 30,813,939 probably benign Het
Pla2g15 G T 8: 106,163,071 G325V probably damaging Het
Ppp1r21 T C 17: 88,572,615 F487L probably benign Het
Ppp1r9a A G 6: 5,157,016 I965V probably benign Het
Ptpru A G 4: 131,820,964 V74A probably damaging Het
Rif1 T A 2: 52,098,934 Y780N probably damaging Het
Rps25 T A 9: 44,408,749 Y23N possibly damaging Het
Ryr1 T C 7: 29,085,833 D1811G probably damaging Het
Scamp5 T G 9: 57,452,036 probably null Het
Senp1 T C 15: 98,045,896 D602G probably damaging Het
Sh2b2 T G 5: 136,231,957 D135A probably damaging Het
Slc26a8 G A 17: 28,638,661 T836M probably benign Het
Slfn4 T G 11: 83,186,821 I145S possibly damaging Het
Spag6l G A 16: 16,777,390 T377I probably benign Het
Spdye4b T C 5: 143,196,334 F129S probably damaging Het
Sspo G A 6: 48,470,580 G2360E probably benign Het
Taar2 A T 10: 23,940,771 I70F probably damaging Het
Taar7e A G 10: 24,038,566 N318S probably damaging Het
Tor1a C A 2: 30,967,730 R42L probably benign Het
Trdn A T 10: 33,474,506 Q690H probably benign Het
Trim56 C A 5: 137,112,725 V646L probably benign Het
Tspan15 T A 10: 62,191,544 K165I probably benign Het
Usp24 A G 4: 106,416,048 Y2210C probably damaging Het
Usp45 A G 4: 21,797,307 T76A probably damaging Het
Vps13c T A 9: 67,878,224 probably null Het
Zfp512b T C 2: 181,585,095 probably benign Het
Zyx C A 6: 42,356,159 probably null Het
Other mutations in Kcna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Kcna4 APN 2 107295862 missense probably damaging 1.00
IGL01025:Kcna4 APN 2 107296391 missense probably damaging 0.99
IGL01433:Kcna4 APN 2 107296733 missense probably damaging 0.99
IGL01805:Kcna4 APN 2 107296498 missense probably damaging 1.00
IGL02121:Kcna4 APN 2 107296618 missense possibly damaging 0.92
Pinched UTSW 2 107296549 missense probably damaging 1.00
PIT4377001:Kcna4 UTSW 2 107296860 missense possibly damaging 0.83
R0255:Kcna4 UTSW 2 107296562 missense probably damaging 1.00
R0650:Kcna4 UTSW 2 107295582 nonsense probably null
R0761:Kcna4 UTSW 2 107296072 missense probably benign 0.02
R1211:Kcna4 UTSW 2 107295315 small deletion probably benign
R1553:Kcna4 UTSW 2 107296687 missense probably benign 0.02
R1854:Kcna4 UTSW 2 107296484 missense probably damaging 1.00
R1915:Kcna4 UTSW 2 107296778 missense probably benign 0.01
R1974:Kcna4 UTSW 2 107296220 missense possibly damaging 0.65
R4002:Kcna4 UTSW 2 107295914 missense probably damaging 1.00
R4163:Kcna4 UTSW 2 107295806 missense probably damaging 1.00
R4413:Kcna4 UTSW 2 107295373 missense probably benign 0.01
R4474:Kcna4 UTSW 2 107296007 missense probably benign
R4492:Kcna4 UTSW 2 107296091 missense probably damaging 1.00
R4525:Kcna4 UTSW 2 107295065 missense possibly damaging 0.93
R4787:Kcna4 UTSW 2 107296468 missense probably damaging 1.00
R5423:Kcna4 UTSW 2 107295806 nonsense probably null
R5725:Kcna4 UTSW 2 107296876 missense possibly damaging 0.48
R6381:Kcna4 UTSW 2 107294972 missense probably benign 0.05
R6399:Kcna4 UTSW 2 107296549 missense probably damaging 1.00
R6787:Kcna4 UTSW 2 107295325 missense possibly damaging 0.91
R6891:Kcna4 UTSW 2 107296307 missense probably damaging 1.00
R7057:Kcna4 UTSW 2 107295320 missense probably damaging 0.96
R7250:Kcna4 UTSW 2 107296318 missense possibly damaging 0.92
R7522:Kcna4 UTSW 2 107296255 missense probably damaging 1.00
R7799:Kcna4 UTSW 2 107295892 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- ACTCCAAAGGCCTGCAGATC -3'
(R):5'- TGGAGCTCCGAAATTTCTTGAGC -3'

Sequencing Primer
(F):5'- CGGGAACTGGGCCTTCTTATC -3'
(R):5'- GCTCCGAAATTTCTTGAGCAAATTAG -3'
Posted On2015-12-21