Incidental Mutation 'R4490:Abl2'
ID330661
Institutional Source Beutler Lab
Gene Symbol Abl2
Ensembl Gene ENSMUSG00000026596
Gene Namev-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene)
SynonymsAbll, Arg
MMRRC Submission 041746-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.502) question?
Stock #R4490 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location156558786-156649568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156633779 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 417 (V417A)
Ref Sequence ENSEMBL: ENSMUSP00000027888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027888] [ENSMUST00000166172] [ENSMUST00000190749]
Predicted Effect probably damaging
Transcript: ENSMUST00000027888
AA Change: V417A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027888
Gene: ENSMUSG00000026596
AA Change: V417A

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
SH3 110 166 9.83e-16 SMART
SH2 171 254 1.34e-33 SMART
TyrKc 288 539 2.53e-148 SMART
low complexity region 561 577 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 734 752 N/A INTRINSIC
low complexity region 877 891 N/A INTRINSIC
low complexity region 974 991 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
FABD 1061 1182 5.24e-65 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166172
AA Change: V417A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126181
Gene: ENSMUSG00000026596
AA Change: V417A

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
SH3 110 166 9.83e-16 SMART
SH2 171 254 1.34e-33 SMART
TyrKc 288 539 2.53e-148 SMART
low complexity region 561 577 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 773 787 N/A INTRINSIC
low complexity region 870 887 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
FABD 957 1078 5.24e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190749
SMART Domains Protein: ENSMUSP00000140125
Gene: ENSMUSG00000026596

DomainStartEndE-ValueType
SH3 103 159 6.2e-18 SMART
SH2 164 247 8.4e-36 SMART
Meta Mutation Damage Score 0.7969 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Abelson family of nonreceptor tyrosine protein kinases. The protein is highly similar to the c-abl oncogene 1 protein, including the tyrosine kinase, SH2 and SH3 domains, and it plays a role in cytoskeletal rearrangements through its C-terminal F-actin- and microtubule-binding sequences. This gene is expressed in both normal and tumor cells, and is involved in translocation with the ets variant 6 gene in leukemia. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display multiple behavioral abnormalities indicating neuronal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 T C 4: 130,012,328 V881A possibly damaging Het
Arl5c G A 11: 97,995,836 R10* probably null Het
Atad1 A G 19: 32,695,797 C229R probably benign Het
Atp6v0a2 T C 5: 124,646,734 V319A probably damaging Het
Cage1 A G 13: 38,023,417 S257P possibly damaging Het
Ccndbp1 A G 2: 121,012,395 D179G probably damaging Het
Cngb3 T C 4: 19,415,684 I398T probably benign Het
Crmp1 A G 5: 37,276,331 D178G probably damaging Het
Csmd3 C T 15: 48,314,033 V370I possibly damaging Het
Dapk1 A G 13: 60,718,128 T180A probably benign Het
Dmtf1 A G 5: 9,140,379 probably benign Het
Dnah12 T C 14: 26,734,603 L827S possibly damaging Het
F5 T C 1: 164,217,395 V2084A probably benign Het
Fan1 A T 7: 64,369,180 S476T possibly damaging Het
Far2 T C 6: 148,173,409 L380P possibly damaging Het
Gbp2 A G 3: 142,623,764 N24S probably benign Het
Gm14325 T C 2: 177,832,983 H101R possibly damaging Het
Gpr55 C T 1: 85,941,818 V14M probably damaging Het
Herc6 A T 6: 57,654,495 Y724F probably damaging Het
Impg1 T A 9: 80,394,059 Q195L probably damaging Het
Inf2 T C 12: 112,600,204 F68L probably damaging Het
Kcnh8 T C 17: 52,961,877 probably null Het
Klb A G 5: 65,375,794 N482S probably benign Het
Kpnb1 A G 11: 97,171,598 V447A probably benign Het
Nckap5l G A 15: 99,426,130 P831S probably benign Het
Ncor2 A G 5: 125,036,815 probably null Het
Olfr32 A T 2: 90,138,917 V74D probably damaging Het
Pgm3 T C 9: 86,561,840 Y337C probably damaging Het
Prdm1 G T 10: 44,446,907 Y197* probably null Het
Prdm4 A T 10: 85,900,899 C626S probably damaging Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Ranbp6 A G 19: 29,810,333 L873P probably damaging Het
Rin2 A G 2: 145,822,274 T23A possibly damaging Het
Rxra G T 2: 27,741,195 R118L probably damaging Het
Spice1 T C 16: 44,382,113 L750P probably damaging Het
Trpm1 C T 7: 64,208,912 Q228* probably null Het
Tsc1 A G 2: 28,670,925 D265G probably damaging Het
Usp29 T C 7: 6,961,950 I264T possibly damaging Het
Vmn2r26 T C 6: 124,050,738 L479P possibly damaging Het
Zfp9 A G 6: 118,465,312 S130P probably benign Het
Other mutations in Abl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Abl2 APN 1 156635184 missense probably damaging 1.00
IGL01679:Abl2 APN 1 156642465 missense probably benign 0.01
IGL02289:Abl2 APN 1 156629854 missense probably damaging 1.00
PIT4495001:Abl2 UTSW 1 156633185 missense probably damaging 1.00
R0907:Abl2 UTSW 1 156629859 missense probably damaging 1.00
R1232:Abl2 UTSW 1 156641730 missense probably damaging 1.00
R2069:Abl2 UTSW 1 156620827 splice site probably null
R4224:Abl2 UTSW 1 156633847 missense probably damaging 0.98
R4305:Abl2 UTSW 1 156641563 missense probably damaging 0.99
R4411:Abl2 UTSW 1 156630082 missense possibly damaging 0.86
R5132:Abl2 UTSW 1 156641832 nonsense probably null
R5383:Abl2 UTSW 1 156642232 missense possibly damaging 0.89
R5428:Abl2 UTSW 1 156642111 missense probably damaging 1.00
R5436:Abl2 UTSW 1 156629880 missense probably damaging 1.00
R5760:Abl2 UTSW 1 156641857 missense probably benign 0.06
R6051:Abl2 UTSW 1 156642085 missense probably damaging 1.00
R6955:Abl2 UTSW 1 156622649 missense probably damaging 1.00
R7002:Abl2 UTSW 1 156559133 missense probably damaging 1.00
R7038:Abl2 UTSW 1 156641409 missense possibly damaging 0.95
R7172:Abl2 UTSW 1 156622587 missense probably damaging 1.00
R7268:Abl2 UTSW 1 156633939 critical splice donor site probably null
R7282:Abl2 UTSW 1 156630060 missense probably damaging 1.00
R7303:Abl2 UTSW 1 156641250 missense probably benign 0.00
R7372:Abl2 UTSW 1 156622619 missense probably damaging 1.00
R7375:Abl2 UTSW 1 156622614 missense probably damaging 1.00
R7443:Abl2 UTSW 1 156625381 missense probably damaging 1.00
R7468:Abl2 UTSW 1 156622534 missense possibly damaging 0.68
R7614:Abl2 UTSW 1 156636859 missense possibly damaging 0.71
R7644:Abl2 UTSW 1 156615993 missense probably benign 0.08
R7783:Abl2 UTSW 1 156559071 missense probably benign
X0067:Abl2 UTSW 1 156631433 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTCCTGGTGGGTATTCAGTACATG -3'
(R):5'- AATCTAGCGAACACCTGGCC -3'

Sequencing Primer
(F):5'- ATTAGTAAGTTTCTACGATGTTGGTG -3'
(R):5'- GTAAGAAATTATGTCAACCTTACCCC -3'
Posted On2015-07-21