Incidental Mutation 'R4478:Sdad1'
List |< first << previous [record 31 of 46] next >> last >|
ID331348
Institutional Source Beutler Lab
Gene Symbol Sdad1
Ensembl Gene ENSMUSG00000029415
Gene NameSDA1 domain containing 1
Synonyms
MMRRC Submission 041735-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R4478 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location92284010-92310479 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92297160 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 315 (M315T)
Ref Sequence ENSEMBL: ENSMUSP00000144446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031364] [ENSMUST00000201143]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031364
AA Change: M316T

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031364
Gene: ENSMUSG00000029415
AA Change: M316T

DomainStartEndE-ValueType
Pfam:NUC130_3NT 62 113 3.3e-28 PFAM
low complexity region 116 126 N/A INTRINSIC
low complexity region 146 163 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 254 278 N/A INTRINSIC
Pfam:SDA1 409 532 2.4e-41 PFAM
Pfam:SDA1 519 685 2.8e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201084
Predicted Effect probably damaging
Transcript: ENSMUST00000201143
AA Change: M315T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144446
Gene: ENSMUSG00000029415
AA Change: M315T

DomainStartEndE-ValueType
Pfam:NUC130_3NT 62 113 5.3e-24 PFAM
low complexity region 116 126 N/A INTRINSIC
low complexity region 146 163 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 254 277 N/A INTRINSIC
Pfam:SDA1 408 531 3.9e-37 PFAM
Pfam:SDA1 518 684 4.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202903
Meta Mutation Damage Score 0.4888 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 94% (46/49)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A T 7: 139,975,860 probably null Het
Adam3 T C 8: 24,695,155 D509G probably benign Het
Ank1 C T 8: 23,120,578 T1379I probably benign Het
Ap1m2 A G 9: 21,298,213 V389A probably benign Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
Chd9 T C 8: 91,034,031 probably benign Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cpne5 T C 17: 29,209,476 T118A probably damaging Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dag1 G C 9: 108,208,730 T404R probably damaging Het
Dnah3 T G 7: 120,071,863 H599P probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fabp9 T C 3: 10,197,106 Y30C probably damaging Het
Fnbp1 G A 2: 31,105,254 A56V probably damaging Het
Gm20498 T C 12: 81,489,216 probably benign Het
Hid1 G A 11: 115,361,655 A67V probably damaging Het
Il6ra T A 3: 89,890,290 Y90F probably damaging Het
Kcnk18 T C 19: 59,235,244 S274P probably damaging Het
Kndc1 A T 7: 139,920,684 D655V probably damaging Het
Lrrk2 G A 15: 91,723,188 A585T probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Myo9b A T 8: 71,291,081 K262M probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1100 G T 2: 86,978,218 R193S probably benign Het
Olfr433 C T 1: 174,042,616 T222I probably benign Het
Olfr779 C T 10: 129,311,776 L90F possibly damaging Het
Plxna4 A T 6: 32,196,133 C1288S possibly damaging Het
Ptpn22 T C 3: 103,902,064 probably benign Het
Rab11fip3 C T 17: 26,016,083 E619K probably damaging Het
Robo2 C A 16: 74,015,873 R311L probably damaging Het
Slc39a12 T A 2: 14,420,179 L407* probably null Het
Snap29 T C 16: 17,428,155 V213A probably benign Het
Stard7 T A 2: 127,284,259 L77Q probably damaging Het
Stat5b A G 11: 100,787,284 Y668H probably benign Het
Tgfb2 A G 1: 186,632,499 I266T probably damaging Het
Tmem87a C T 2: 120,369,343 W440* probably null Het
Tnr T A 1: 159,884,756 probably null Het
Ubl3 C T 5: 148,511,977 S18N probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r9 T C 5: 108,846,277 E502G probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Vwa8 T A 14: 78,868,801 D61E probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp1 A G 8: 111,670,543 R366G probably damaging Het
Zfp282 A T 6: 47,890,696 R269* probably null Het
Other mutations in Sdad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Sdad1 APN 5 92303773 splice site probably null
IGL01355:Sdad1 APN 5 92302679 missense probably damaging 1.00
IGL01635:Sdad1 APN 5 92297160 missense probably damaging 0.98
IGL02166:Sdad1 APN 5 92291762 missense probably benign 0.03
IGL02503:Sdad1 APN 5 92301802 unclassified probably benign
IGL02739:Sdad1 APN 5 92290072 missense probably benign 0.43
PIT4468001:Sdad1 UTSW 5 92291918 missense probably damaging 1.00
R0583:Sdad1 UTSW 5 92305064 missense probably damaging 0.97
R1169:Sdad1 UTSW 5 92298233 missense probably benign 0.32
R1496:Sdad1 UTSW 5 92309823 missense possibly damaging 0.94
R1844:Sdad1 UTSW 5 92305296 nonsense probably null
R1848:Sdad1 UTSW 5 92292651 critical splice donor site probably null
R2419:Sdad1 UTSW 5 92305818 missense possibly damaging 0.69
R2497:Sdad1 UTSW 5 92300099 missense probably benign 0.00
R2509:Sdad1 UTSW 5 92305825 missense probably benign 0.12
R4043:Sdad1 UTSW 5 92302694 missense probably damaging 0.96
R4384:Sdad1 UTSW 5 92298257 missense probably benign 0.01
R4477:Sdad1 UTSW 5 92297160 missense probably damaging 0.98
R4734:Sdad1 UTSW 5 92304977 missense possibly damaging 0.61
R4749:Sdad1 UTSW 5 92304977 missense possibly damaging 0.61
R5135:Sdad1 UTSW 5 92303934 missense probably benign 0.00
R5288:Sdad1 UTSW 5 92286825 makesense probably null
R6331:Sdad1 UTSW 5 92303930 missense probably damaging 1.00
R7038:Sdad1 UTSW 5 92298190 critical splice donor site probably null
R7099:Sdad1 UTSW 5 92293973 missense possibly damaging 0.89
R7420:Sdad1 UTSW 5 92305737 missense possibly damaging 0.91
R7425:Sdad1 UTSW 5 92300121 missense probably benign 0.10
R7714:Sdad1 UTSW 5 92302679 missense probably damaging 1.00
R8048:Sdad1 UTSW 5 92300089 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATAAAAGCAGCTGCCTTCAG -3'
(R):5'- TTTGCACCGCTAGGACTTTGC -3'

Sequencing Primer
(F):5'- CTTCAGAAGGATAGGCTGCACTTG -3'
(R):5'- GCTGTCCCTTCCCCTGGG -3'
Posted On2015-07-21