Incidental Mutation 'R4564:Gm10770'
ID343228
Institutional Source Beutler Lab
Gene Symbol Gm10770
Ensembl Gene ENSMUSG00000074837
Gene Namepredicted gene 10770
Synonyms
MMRRC Submission 041789-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R4564 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location150178882-150179679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150178911 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 229 (T229A)
Ref Sequence ENSEMBL: ENSMUSP00000097015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099418] [ENSMUST00000109926]
Predicted Effect probably benign
Transcript: ENSMUST00000099418
AA Change: T229A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000097015
Gene: ENSMUSG00000074837
AA Change: T229A

DomainStartEndE-ValueType
ZnF_C2H2 12 34 8.09e0 SMART
ZnF_C2H2 40 62 8.4e1 SMART
ZnF_C2H2 68 90 1.12e-3 SMART
ZnF_C2H2 96 118 3.47e1 SMART
ZnF_C2H2 124 146 1.09e2 SMART
ZnF_C2H2 152 174 3.58e-2 SMART
ZnF_C2H2 180 202 6.23e-2 SMART
ZnF_C2H2 208 230 2.49e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109926
SMART Domains Protein: ENSMUSP00000105552
Gene: ENSMUSG00000079009

DomainStartEndE-ValueType
Blast:KRAB 1 34 7e-15 BLAST
ZnF_C2H2 71 93 8.6e-5 SMART
ZnF_C2H2 99 121 1.76e-1 SMART
ZnF_C2H2 127 149 3.02e0 SMART
ZnF_C2H2 183 205 6.08e-5 SMART
ZnF_C2H2 211 233 1.04e-3 SMART
ZnF_C2H2 239 261 2.57e-3 SMART
ZnF_C2H2 267 289 1.06e-4 SMART
ZnF_C2H2 295 317 2.2e-2 SMART
ZnF_C2H2 323 345 4.47e-3 SMART
ZnF_C2H2 351 373 7.37e-4 SMART
ZnF_C2H2 379 401 4.24e-4 SMART
ZnF_C2H2 407 429 1.2e-3 SMART
ZnF_C2H2 435 457 2.61e-4 SMART
Meta Mutation Damage Score 0.3644 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad3a C T 4: 155,747,309 probably null Het
Bach2 T G 4: 32,563,338 S602A probably damaging Het
Ccl19 G T 4: 42,756,295 S12R probably damaging Het
Cfap54 T C 10: 92,839,540 probably benign Het
Cndp1 T A 18: 84,622,286 I265F probably damaging Het
Cnot3 G A 7: 3,653,258 R181H probably damaging Het
Dicer1 T A 12: 104,704,751 K1011* probably null Het
Dip2b G A 15: 100,157,258 W99* probably null Het
Fam129c T C 8: 71,605,060 probably benign Het
Fpr-rs6 A T 17: 20,182,906 Y64* probably null Het
Fubp1 C A 3: 152,222,936 Y480* probably null Het
Gfra1 T C 19: 58,239,250 probably null Het
Gm826 A C 2: 160,311,993 probably benign Het
Gpd2 G A 2: 57,307,083 V217I possibly damaging Het
Hectd4 T C 5: 121,350,431 I3595T probably benign Het
Lmln A G 16: 33,109,856 E561G probably benign Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Man2a2 T A 7: 80,368,838 Y91F probably benign Het
Map4k4 A G 1: 39,988,975 T319A probably damaging Het
Mcm6 G T 1: 128,343,459 H474Q probably damaging Het
Mn1 C G 5: 111,420,667 N834K possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npas2 A G 1: 39,287,566 D44G probably damaging Het
Npc1 C T 18: 12,191,732 G1235R probably damaging Het
Olfml2a C T 2: 38,960,294 T674I probably benign Het
Olfr1311 A G 2: 112,021,767 L29P possibly damaging Het
Plxnb1 C T 9: 109,113,420 A1779V probably benign Het
Ppil3 T A 1: 58,431,322 D123V probably damaging Het
Prr23a3 A G 9: 98,865,137 E48G probably damaging Het
Prr5l T C 2: 101,746,749 E110G probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
R3hdm1 C T 1: 128,221,659 T839M probably benign Het
Rasgrf2 G A 13: 91,885,654 Q544* probably null Het
Riok3 C A 18: 12,148,879 R302S probably damaging Het
Rnf145 A G 11: 44,548,808 K144E probably benign Het
Sin3b A C 8: 72,753,581 T904P probably damaging Het
Skint4 C T 4: 112,119,869 T152M probably damaging Het
Slc22a2 A G 17: 12,610,056 I350V probably benign Het
Slc6a11 G T 6: 114,131,362 G29V probably benign Het
Speg A C 1: 75,391,834 H676P probably damaging Het
St6gal2 T A 17: 55,482,647 H227Q probably damaging Het
Strn3 A G 12: 51,633,621 S399P probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tmem8 A G 17: 26,117,863 R252G possibly damaging Het
Trpm6 T C 19: 18,832,597 L1119P possibly damaging Het
Upf2 A C 2: 6,027,312 T890P unknown Het
Upk1b T A 16: 38,780,107 K170N probably benign Het
Vmn1r78 A T 7: 12,152,558 Y32F probably damaging Het
Vps11 A G 9: 44,361,597 F12S probably damaging Het
Zfp318 T A 17: 46,412,815 C1915S possibly damaging Het
Zfp346 A C 13: 55,113,707 R103S probably damaging Het
Other mutations in Gm10770
AlleleSourceChrCoordTypePredicted EffectPPH Score
F5770:Gm10770 UTSW 2 150179484 nonsense probably null
R1765:Gm10770 UTSW 2 150179338 missense probably damaging 1.00
R1842:Gm10770 UTSW 2 150179156 missense probably damaging 1.00
R3438:Gm10770 UTSW 2 150179549 unclassified probably null
R4863:Gm10770 UTSW 2 150178896 nonsense probably null
R5134:Gm10770 UTSW 2 150179560 splice site probably null
R5424:Gm10770 UTSW 2 150179028 missense probably benign 0.01
R5429:Gm10770 UTSW 2 150179423 missense probably benign 0.00
R5976:Gm10770 UTSW 2 150179400 nonsense probably null
R6436:Gm10770 UTSW 2 150178910 missense probably benign 0.07
R6679:Gm10770 UTSW 2 150179649 missense probably damaging 1.00
V7580:Gm10770 UTSW 2 150179484 nonsense probably null
V7581:Gm10770 UTSW 2 150179484 nonsense probably null
V7583:Gm10770 UTSW 2 150179484 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCCAGATGTCTCTCAACAGAC -3'
(R):5'- CTTTGCACATCAGTATGGTCTCT -3'

Sequencing Primer
(F):5'- TGTCTCTCAACAGACGAATGG -3'
(R):5'- GGTCAAGCCTTTAGAGTTCACAGTC -3'
Posted On2015-09-24