Incidental Mutation 'R4564:Map4k4'
ID343217
Institutional Source Beutler Lab
Gene Symbol Map4k4
Ensembl Gene ENSMUSG00000026074
Gene Namemitogen-activated protein kinase kinase kinase kinase 4
Synonyms9430080K19Rik, Nik
MMRRC Submission 041789-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4564 (G1)
Quality Score218
Status Validated
Chromosome1
Chromosomal Location39900913-40026310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39988975 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 319 (T319A)
Ref Sequence ENSEMBL: ENSMUSP00000142056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163854] [ENSMUST00000168431] [ENSMUST00000191761] [ENSMUST00000192509] [ENSMUST00000193682] [ENSMUST00000195259] [ENSMUST00000195636] [ENSMUST00000195860]
Predicted Effect unknown
Transcript: ENSMUST00000163854
AA Change: T319A
SMART Domains Protein: ENSMUSP00000126961
Gene: ENSMUSG00000026074
AA Change: T319A

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 721 747 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 811 837 N/A INTRINSIC
low complexity region 891 904 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
CNH 970 1268 2.76e-127 SMART
Predicted Effect unknown
Transcript: ENSMUST00000168431
AA Change: T319A
SMART Domains Protein: ENSMUSP00000129796
Gene: ENSMUSG00000026074
AA Change: T319A

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 633 644 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
low complexity region 700 709 N/A INTRINSIC
low complexity region 757 783 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
CNH 916 1214 2.76e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191761
AA Change: T319A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000141332
Gene: ENSMUSG00000026074
AA Change: T319A

DomainStartEndE-ValueType
S_TKc 25 289 3.4e-97 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 404 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192509
AA Change: T319A

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141665
Gene: ENSMUSG00000026074
AA Change: T319A

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 633 644 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
low complexity region 700 709 N/A INTRINSIC
low complexity region 757 783 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
CNH 916 1214 2.76e-127 SMART
Predicted Effect unknown
Transcript: ENSMUST00000193682
AA Change: T319A
SMART Domains Protein: ENSMUSP00000141862
Gene: ENSMUSG00000026074
AA Change: T319A

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 590 616 N/A INTRINSIC
low complexity region 623 632 N/A INTRINSIC
low complexity region 680 706 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
low complexity region 824 837 N/A INTRINSIC
low complexity region 852 862 N/A INTRINSIC
CNH 903 1201 2.76e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195259
AA Change: T319A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142056
Gene: ENSMUSG00000026074
AA Change: T319A

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 644 670 N/A INTRINSIC
low complexity region 677 686 N/A INTRINSIC
low complexity region 731 757 N/A INTRINSIC
low complexity region 811 824 N/A INTRINSIC
low complexity region 839 849 N/A INTRINSIC
CNH 890 1188 2.76e-127 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000195636
AA Change: T319A

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141613
Gene: ENSMUSG00000026074
AA Change: T319A

DomainStartEndE-ValueType
S_TKc 25 289 3.4e-97 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 644 670 N/A INTRINSIC
low complexity region 677 686 N/A INTRINSIC
low complexity region 731 757 N/A INTRINSIC
low complexity region 836 865 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
CNH 954 1252 1.4e-129 SMART
Predicted Effect unknown
Transcript: ENSMUST00000195860
AA Change: T319A
SMART Domains Protein: ENSMUSP00000141400
Gene: ENSMUSG00000026074
AA Change: T319A

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 721 747 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 811 837 N/A INTRINSIC
low complexity region 891 904 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
CNH 970 1268 2.76e-127 SMART
Meta Mutation Damage Score 0.1394 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase has been shown to specifically activate MAPK8/JNK. The activation of MAPK8 by this kinase is found to be inhibited by the dominant-negative mutants of MAP3K7/TAK1, MAP2K4/MKK4, and MAP2K7/MKK7, which suggests that this kinase may function through the MAP3K7-MAP2K4-MAP2K7 kinase cascade, and mediate the TNF-alpha signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos around day E9.5-10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad3a C T 4: 155,747,309 probably null Het
Bach2 T G 4: 32,563,338 S602A probably damaging Het
Ccl19 G T 4: 42,756,295 S12R probably damaging Het
Cfap54 T C 10: 92,839,540 probably benign Het
Cndp1 T A 18: 84,622,286 I265F probably damaging Het
Cnot3 G A 7: 3,653,258 R181H probably damaging Het
Dicer1 T A 12: 104,704,751 K1011* probably null Het
Dip2b G A 15: 100,157,258 W99* probably null Het
Fam129c T C 8: 71,605,060 probably benign Het
Fpr-rs6 A T 17: 20,182,906 Y64* probably null Het
Fubp1 C A 3: 152,222,936 Y480* probably null Het
Gfra1 T C 19: 58,239,250 probably null Het
Gm10770 T C 2: 150,178,911 T229A probably benign Het
Gm826 A C 2: 160,311,993 probably benign Het
Gpd2 G A 2: 57,307,083 V217I possibly damaging Het
Hectd4 T C 5: 121,350,431 I3595T probably benign Het
Lmln A G 16: 33,109,856 E561G probably benign Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Man2a2 T A 7: 80,368,838 Y91F probably benign Het
Mcm6 G T 1: 128,343,459 H474Q probably damaging Het
Mn1 C G 5: 111,420,667 N834K possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npas2 A G 1: 39,287,566 D44G probably damaging Het
Npc1 C T 18: 12,191,732 G1235R probably damaging Het
Olfml2a C T 2: 38,960,294 T674I probably benign Het
Olfr1311 A G 2: 112,021,767 L29P possibly damaging Het
Plxnb1 C T 9: 109,113,420 A1779V probably benign Het
Ppil3 T A 1: 58,431,322 D123V probably damaging Het
Prr23a3 A G 9: 98,865,137 E48G probably damaging Het
Prr5l T C 2: 101,746,749 E110G probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
R3hdm1 C T 1: 128,221,659 T839M probably benign Het
Rasgrf2 G A 13: 91,885,654 Q544* probably null Het
Riok3 C A 18: 12,148,879 R302S probably damaging Het
Rnf145 A G 11: 44,548,808 K144E probably benign Het
Sin3b A C 8: 72,753,581 T904P probably damaging Het
Skint4 C T 4: 112,119,869 T152M probably damaging Het
Slc22a2 A G 17: 12,610,056 I350V probably benign Het
Slc6a11 G T 6: 114,131,362 G29V probably benign Het
Speg A C 1: 75,391,834 H676P probably damaging Het
St6gal2 T A 17: 55,482,647 H227Q probably damaging Het
Strn3 A G 12: 51,633,621 S399P probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tmem8 A G 17: 26,117,863 R252G possibly damaging Het
Trpm6 T C 19: 18,832,597 L1119P possibly damaging Het
Upf2 A C 2: 6,027,312 T890P unknown Het
Upk1b T A 16: 38,780,107 K170N probably benign Het
Vmn1r78 A T 7: 12,152,558 Y32F probably damaging Het
Vps11 A G 9: 44,361,597 F12S probably damaging Het
Zfp318 T A 17: 46,412,815 C1915S possibly damaging Het
Zfp346 A C 13: 55,113,707 R103S probably damaging Het
Other mutations in Map4k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Map4k4 APN 1 40004816 missense probably damaging 0.99
IGL00417:Map4k4 APN 1 40014532 missense possibly damaging 0.92
IGL00516:Map4k4 APN 1 40014602 missense probably damaging 1.00
IGL01545:Map4k4 APN 1 40014229 splice site probably benign
IGL02092:Map4k4 APN 1 39986783 missense probably benign 0.12
IGL02092:Map4k4 APN 1 40024348 missense probably damaging 1.00
IGL02570:Map4k4 APN 1 39980579 missense probably benign 0.06
IGL02626:Map4k4 APN 1 40014097 splice site probably benign
IGL02993:Map4k4 APN 1 40014188 missense probably damaging 0.98
IGL03178:Map4k4 APN 1 39986693 missense possibly damaging 0.63
tank UTSW 1 40004864 missense possibly damaging 0.93
IGL02835:Map4k4 UTSW 1 40010600 missense probably damaging 0.99
R0496:Map4k4 UTSW 1 40006822 missense probably damaging 0.99
R0498:Map4k4 UTSW 1 39990178 missense probably benign 0.22
R0588:Map4k4 UTSW 1 40004864 missense possibly damaging 0.93
R0674:Map4k4 UTSW 1 40003815 missense probably damaging 1.00
R1205:Map4k4 UTSW 1 40003844 missense probably damaging 1.00
R1349:Map4k4 UTSW 1 40021159 missense probably damaging 1.00
R1615:Map4k4 UTSW 1 40006830 splice site probably benign
R1763:Map4k4 UTSW 1 40000757 splice site probably benign
R1800:Map4k4 UTSW 1 40023460 missense probably damaging 1.00
R1893:Map4k4 UTSW 1 40001557 missense probably benign 0.08
R2411:Map4k4 UTSW 1 40007496 missense probably damaging 0.96
R2851:Map4k4 UTSW 1 40000755 splice site probably benign
R2852:Map4k4 UTSW 1 40000755 splice site probably benign
R2987:Map4k4 UTSW 1 39986765 missense probably damaging 1.00
R3087:Map4k4 UTSW 1 40021082 critical splice acceptor site probably null
R3688:Map4k4 UTSW 1 39985171 splice site probably null
R4075:Map4k4 UTSW 1 40023462 missense probably damaging 0.96
R4304:Map4k4 UTSW 1 39973972 missense possibly damaging 0.74
R4569:Map4k4 UTSW 1 40000538 missense probably damaging 1.00
R4613:Map4k4 UTSW 1 40017191 missense probably benign 0.05
R4715:Map4k4 UTSW 1 40019564 missense probably damaging 1.00
R4788:Map4k4 UTSW 1 40003916 missense probably benign 0.01
R4926:Map4k4 UTSW 1 40017225 missense probably damaging 1.00
R4943:Map4k4 UTSW 1 40019594 missense probably damaging 0.99
R5033:Map4k4 UTSW 1 40007502 missense probably damaging 0.99
R5177:Map4k4 UTSW 1 39986762 missense probably damaging 1.00
R5297:Map4k4 UTSW 1 39962217 missense probably damaging 1.00
R5844:Map4k4 UTSW 1 39999876 splice site probably benign
R5952:Map4k4 UTSW 1 39999922 unclassified probably benign
R6111:Map4k4 UTSW 1 40011662 missense probably benign 0.00
R6125:Map4k4 UTSW 1 40003965 missense possibly damaging 0.77
R6838:Map4k4 UTSW 1 39976722 missense probably damaging 1.00
R6927:Map4k4 UTSW 1 40011682 missense probably benign 0.00
R7008:Map4k4 UTSW 1 39988971 missense probably benign 0.44
R7164:Map4k4 UTSW 1 39973972 missense possibly damaging 0.74
R7195:Map4k4 UTSW 1 40019669 missense possibly damaging 0.93
R7352:Map4k4 UTSW 1 39962227 missense unknown
R7589:Map4k4 UTSW 1 40021091 nonsense probably null
R7816:Map4k4 UTSW 1 40014208 missense possibly damaging 0.53
R7869:Map4k4 UTSW 1 39974044 missense unknown
R7952:Map4k4 UTSW 1 39974044 missense unknown
R8013:Map4k4 UTSW 1 39962212 missense unknown
R8145:Map4k4 UTSW 1 40000534 missense
R8154:Map4k4 UTSW 1 40021142 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGGAGAATGACCAGCTCTTC -3'
(R):5'- CAGAGATCTGTCATGGGGTG -3'

Sequencing Primer
(F):5'- AGAATGACCAGCTCTTCTGTAGG -3'
(R):5'- TCTGTCATGGGGTGAGAAAAATG -3'
Posted On2015-09-24