Incidental Mutation 'R4595:Dpp8'
ID344329
Institutional Source Beutler Lab
Gene Symbol Dpp8
Ensembl Gene ENSMUSG00000032393
Gene Namedipeptidylpeptidase 8
Synonyms2310004I03Rik, 4932434F09Rik
MMRRC Submission 041811-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.523) question?
Stock #R4595 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location65032414-65082651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65075803 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 739 (D739G)
Ref Sequence ENSEMBL: ENSMUSP00000126065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034960] [ENSMUST00000167773] [ENSMUST00000217434]
Predicted Effect probably damaging
Transcript: ENSMUST00000034960
AA Change: D739G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034960
Gene: ENSMUSG00000032393
AA Change: D739G

DomainStartEndE-ValueType
low complexity region 144 154 N/A INTRINSIC
Pfam:DPPIV_N 168 589 1e-100 PFAM
Pfam:Peptidase_S15 636 830 7.3e-11 PFAM
Pfam:Abhydrolase_5 671 860 4.8e-9 PFAM
Pfam:Peptidase_S9 676 885 6.5e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167773
AA Change: D739G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126065
Gene: ENSMUSG00000032393
AA Change: D739G

DomainStartEndE-ValueType
low complexity region 144 154 N/A INTRINSIC
Pfam:DPPIV_N 168 589 3.3e-102 PFAM
Pfam:Peptidase_S15 636 830 7.3e-11 PFAM
Pfam:Abhydrolase_5 670 860 6.5e-9 PFAM
Pfam:Peptidase_S9 677 885 8.6e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217328
Predicted Effect probably benign
Transcript: ENSMUST00000217434
Meta Mutation Damage Score 0.9721 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S9B family, a small family of dipeptidyl peptidases that are able to cleave peptide substrates at a prolyl bond. The encoded protein shares similarity with dipeptidyl peptidase IV in that it is ubiquitously expressed, and hydrolyzes the same substrates. These similarities suggest that, like dipeptidyl peptidase IV, this protein may play a role in T-cell activation and immune function. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921536K21Rik A G 11: 3,890,052 I115T probably benign Het
Acads A T 5: 115,113,064 N120K probably damaging Het
Aco1 T A 4: 40,167,139 C118S probably benign Het
Alpk2 T C 18: 65,289,748 T1493A probably damaging Het
AU018091 A G 7: 3,158,428 Y480H possibly damaging Het
Brd4 A T 17: 32,198,922 I86N probably damaging Het
Ccdc180 A G 4: 45,945,023 E1477G probably damaging Het
Ccne2 A G 4: 11,202,986 N368S probably benign Het
Cenpp A T 13: 49,641,234 F152L probably benign Het
Cfap46 T A 7: 139,652,404 D881V possibly damaging Het
Chmp7 A G 14: 69,721,229 V212A probably damaging Het
Col9a2 A T 4: 121,045,155 K196N probably benign Het
Copg2 T C 6: 30,749,450 D814G probably damaging Het
Dcaf13 G A 15: 39,118,893 G85R probably damaging Het
Dnah9 A G 11: 66,168,152 S106P probably benign Het
Drd2 T A 9: 49,404,789 M283K probably benign Het
Espl1 A G 15: 102,298,724 T208A probably benign Het
Glul G A 1: 153,903,050 G35D possibly damaging Het
Gm14412 T C 2: 177,315,212 K297E unknown Het
Gm21976 A T 13: 98,305,810 R120W probably damaging Het
Hipk3 T A 2: 104,441,277 T437S probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lipn T G 19: 34,081,350 Y321D probably damaging Het
Lrwd1 A G 5: 136,123,956 V484A probably benign Het
Madd T C 2: 91,167,664 D673G possibly damaging Het
Marveld1 T A 19: 42,147,764 L39Q probably damaging Het
Mfsd2b T C 12: 4,865,807 T299A possibly damaging Het
Micu3 T C 8: 40,359,397 probably benign Het
Mmp7 T C 9: 7,697,666 V234A probably damaging Het
Nhsl1 T A 10: 18,527,609 D1329E probably benign Het
Olfr1234 C T 2: 89,363,325 V35M probably damaging Het
Olfr1307 T C 2: 111,944,652 D268G possibly damaging Het
Olfr622 A G 7: 103,640,101 F13S probably damaging Het
Pcdhb21 T A 18: 37,514,515 D232E probably damaging Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3cb A G 9: 99,055,406 Y745H possibly damaging Het
Pld2 T C 11: 70,542,020 L170P probably damaging Het
Ptch1 T C 13: 63,543,608 D277G possibly damaging Het
Rab11fip1 A T 8: 27,154,575 M394K probably damaging Het
Rhoq T C 17: 86,964,326 Y57H probably benign Het
Setbp1 T C 18: 78,857,516 I979V probably benign Het
Slc6a4 A G 11: 77,019,863 I447V probably benign Het
Sos2 T C 12: 69,616,889 K607R probably damaging Het
Stt3a T C 9: 36,735,512 I602V probably damaging Het
Syne2 A T 12: 75,967,071 Q3012L possibly damaging Het
Taf1b T A 12: 24,500,442 F9I possibly damaging Het
Tex35 T A 1: 157,099,339 Y195F probably benign Het
Tnc T C 4: 63,995,745 T1277A probably damaging Het
Tnfsf15 G T 4: 63,729,943 Y153* probably null Het
Trim5 C A 7: 104,265,432 V477F probably damaging Het
Trp73 A G 4: 154,064,417 I245T probably damaging Het
Zbtb16 C T 9: 48,832,080 E311K possibly damaging Het
Zmynd19 A G 2: 24,958,988 D165G probably damaging Het
Other mutations in Dpp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Dpp8 APN 9 65078008 missense probably damaging 1.00
IGL00576:Dpp8 APN 9 65043829 missense probably benign 0.32
IGL01303:Dpp8 APN 9 65055012 splice site probably benign
IGL01506:Dpp8 APN 9 65063417 splice site probably benign
IGL01544:Dpp8 APN 9 65054988 missense probably benign 0.05
IGL02387:Dpp8 APN 9 65045716 missense probably damaging 1.00
IGL02567:Dpp8 APN 9 65078776 nonsense probably null
IGL02611:Dpp8 APN 9 65055793 missense probably benign 0.15
IGL02723:Dpp8 APN 9 65042267 missense possibly damaging 0.91
IGL02927:Dpp8 APN 9 65060269 missense probably benign 0.09
IGL03116:Dpp8 APN 9 65066467 missense probably damaging 0.96
IGL03135:Dpp8 APN 9 65053040 splice site probably null
IGL03356:Dpp8 APN 9 65045787 missense probably benign 0.00
IGL03050:Dpp8 UTSW 9 65054836 missense probably benign 0.00
R0498:Dpp8 UTSW 9 65045795 splice site probably benign
R0594:Dpp8 UTSW 9 65036998 missense probably damaging 1.00
R0675:Dpp8 UTSW 9 65066502 splice site probably benign
R0699:Dpp8 UTSW 9 65054894 missense probably benign 0.01
R0831:Dpp8 UTSW 9 65078679 missense possibly damaging 0.56
R1148:Dpp8 UTSW 9 65053832 critical splice donor site probably null
R1148:Dpp8 UTSW 9 65053832 critical splice donor site probably null
R1512:Dpp8 UTSW 9 65063814 splice site probably benign
R1515:Dpp8 UTSW 9 65078748 missense probably benign 0.04
R1546:Dpp8 UTSW 9 65063493 missense possibly damaging 0.76
R1556:Dpp8 UTSW 9 65051479 missense probably damaging 1.00
R2027:Dpp8 UTSW 9 65078774 missense probably damaging 1.00
R2104:Dpp8 UTSW 9 65074567 synonymous probably null
R2113:Dpp8 UTSW 9 65063868 missense probably benign 0.00
R2656:Dpp8 UTSW 9 65080804 missense probably damaging 1.00
R4237:Dpp8 UTSW 9 65054923 missense probably benign
R4238:Dpp8 UTSW 9 65054923 missense probably benign
R4239:Dpp8 UTSW 9 65054923 missense probably benign
R4614:Dpp8 UTSW 9 65066396 missense probably benign 0.00
R4946:Dpp8 UTSW 9 65055918 missense probably benign 0.00
R5338:Dpp8 UTSW 9 65063924 nonsense probably null
R5378:Dpp8 UTSW 9 65078014 missense probably damaging 1.00
R5506:Dpp8 UTSW 9 65078109 splice site probably null
R5644:Dpp8 UTSW 9 65045735 nonsense probably null
R5862:Dpp8 UTSW 9 65045722 missense probably benign 0.03
R6437:Dpp8 UTSW 9 65074578 missense probably benign 0.01
R6783:Dpp8 UTSW 9 65063562 missense possibly damaging 0.76
R6863:Dpp8 UTSW 9 65035008 missense probably damaging 0.98
R7192:Dpp8 UTSW 9 65045786 missense possibly damaging 0.70
R7461:Dpp8 UTSW 9 65053120 missense possibly damaging 0.86
R7514:Dpp8 UTSW 9 65078754 missense probably damaging 1.00
R7548:Dpp8 UTSW 9 65037235 missense probably damaging 1.00
R7584:Dpp8 UTSW 9 65078782 missense probably damaging 0.98
R7605:Dpp8 UTSW 9 65054958 missense probably benign 0.33
R7613:Dpp8 UTSW 9 65053120 missense possibly damaging 0.86
R7665:Dpp8 UTSW 9 65078718 missense probably damaging 1.00
R7698:Dpp8 UTSW 9 65042336 missense probably benign 0.00
R7844:Dpp8 UTSW 9 65045667 missense probably damaging 0.99
R7927:Dpp8 UTSW 9 65045667 missense probably damaging 0.99
Z1177:Dpp8 UTSW 9 65063866 frame shift probably null
Z1177:Dpp8 UTSW 9 65066485 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAAAAGAGAAACTCTCCAGG -3'
(R):5'- CTTCCAGGTGTCTTCGATGAACAG -3'

Sequencing Primer
(F):5'- AAGAGAAACTCTCCAGGAATTTTTAG -3'
(R):5'- CCAGGTGTCTTCGATGAACAGAATTC -3'
Posted On2015-09-25