Incidental Mutation 'R4595:Tnfsf15'
ID 344312
Institutional Source Beutler Lab
Gene Symbol Tnfsf15
Ensembl Gene ENSMUSG00000050395
Gene Name tumor necrosis factor (ligand) superfamily, member 15
Synonyms TL1, VEGI, TL1A
MMRRC Submission 041811-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R4595 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 63727084-63745113 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 63729943 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 153 (Y153*)
Ref Sequence ENSEMBL: ENSMUSP00000050144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062246]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000062246
AA Change: Y153*
SMART Domains Protein: ENSMUSP00000050144
Gene: ENSMUSG00000050395
AA Change: Y153*

DomainStartEndE-ValueType
transmembrane domain 56 78 N/A INTRINSIC
TNF 114 270 1.25e-28 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This protein is abundantly expressed in endothelial cells, but is not expressed in either B or T cells. The expression of this protein is inducible by TNF and IL-1 alpha. This cytokine is a ligand for receptor TNFRSF25 and decoy receptor TNFRSF21/DR6. It can activate NF-kappaB and MAP kinases, and acts as an autocrine factor to induce apoptosis in endothelial cells. This cytokine is also found to inhibit endothelial cell proliferation, and thus may function as an angiogenesis inhibitor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous targeted mutants display decreased clinical severity in experimental autoimmune encephalomyelitis (EAE) and collagen-induced arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921536K21Rik A G 11: 3,890,052 I115T probably benign Het
Acads A T 5: 115,113,064 N120K probably damaging Het
Aco1 T A 4: 40,167,139 C118S probably benign Het
Alpk2 T C 18: 65,289,748 T1493A probably damaging Het
AU018091 A G 7: 3,158,428 Y480H possibly damaging Het
Brd4 A T 17: 32,198,922 I86N probably damaging Het
Ccdc180 A G 4: 45,945,023 E1477G probably damaging Het
Ccne2 A G 4: 11,202,986 N368S probably benign Het
Cenpp A T 13: 49,641,234 F152L probably benign Het
Cfap46 T A 7: 139,652,404 D881V possibly damaging Het
Chmp7 A G 14: 69,721,229 V212A probably damaging Het
Col9a2 A T 4: 121,045,155 K196N probably benign Het
Copg2 T C 6: 30,749,450 D814G probably damaging Het
Dcaf13 G A 15: 39,118,893 G85R probably damaging Het
Dnah9 A G 11: 66,168,152 S106P probably benign Het
Dpp8 A G 9: 65,075,803 D739G probably damaging Het
Drd2 T A 9: 49,404,789 M283K probably benign Het
Espl1 A G 15: 102,298,724 T208A probably benign Het
Glul G A 1: 153,903,050 G35D possibly damaging Het
Gm14412 T C 2: 177,315,212 K297E unknown Het
Gm21976 A T 13: 98,305,810 R120W probably damaging Het
Hipk3 T A 2: 104,441,277 T437S probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lipn T G 19: 34,081,350 Y321D probably damaging Het
Lrwd1 A G 5: 136,123,956 V484A probably benign Het
Madd T C 2: 91,167,664 D673G possibly damaging Het
Marveld1 T A 19: 42,147,764 L39Q probably damaging Het
Mfsd2b T C 12: 4,865,807 T299A possibly damaging Het
Micu3 T C 8: 40,359,397 probably benign Het
Mmp7 T C 9: 7,697,666 V234A probably damaging Het
Nhsl1 T A 10: 18,527,609 D1329E probably benign Het
Olfr1234 C T 2: 89,363,325 V35M probably damaging Het
Olfr1307 T C 2: 111,944,652 D268G possibly damaging Het
Olfr622 A G 7: 103,640,101 F13S probably damaging Het
Pcdhb21 T A 18: 37,514,515 D232E probably damaging Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3cb A G 9: 99,055,406 Y745H possibly damaging Het
Pld2 T C 11: 70,542,020 L170P probably damaging Het
Ptch1 T C 13: 63,543,608 D277G possibly damaging Het
Rab11fip1 A T 8: 27,154,575 M394K probably damaging Het
Rhoq T C 17: 86,964,326 Y57H probably benign Het
Setbp1 T C 18: 78,857,516 I979V probably benign Het
Slc6a4 A G 11: 77,019,863 I447V probably benign Het
Sos2 T C 12: 69,616,889 K607R probably damaging Het
Stt3a T C 9: 36,735,512 I602V probably damaging Het
Syne2 A T 12: 75,967,071 Q3012L possibly damaging Het
Taf1b T A 12: 24,500,442 F9I possibly damaging Het
Tex35 T A 1: 157,099,339 Y195F probably benign Het
Tnc T C 4: 63,995,745 T1277A probably damaging Het
Trim5 C A 7: 104,265,432 V477F probably damaging Het
Trp73 A G 4: 154,064,417 I245T probably damaging Het
Zbtb16 C T 9: 48,832,080 E311K possibly damaging Het
Zmynd19 A G 2: 24,958,988 D165G probably damaging Het
Other mutations in Tnfsf15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00674:Tnfsf15 APN 4 63734246 splice site probably benign
IGL00743:Tnfsf15 APN 4 63734281 missense probably benign 0.00
IGL03189:Tnfsf15 APN 4 63730052 splice site probably benign
R0158:Tnfsf15 UTSW 4 63729992 missense possibly damaging 0.95
R1824:Tnfsf15 UTSW 4 63733351 missense probably benign 0.03
R3122:Tnfsf15 UTSW 4 63734285 missense probably benign 0.00
R5025:Tnfsf15 UTSW 4 63729888 missense probably benign 0.01
R6123:Tnfsf15 UTSW 4 63744925 missense probably benign 0.00
R6376:Tnfsf15 UTSW 4 63745030 missense probably damaging 0.98
R7104:Tnfsf15 UTSW 4 63729650 missense probably damaging 1.00
R7173:Tnfsf15 UTSW 4 63729652 missense probably damaging 1.00
R9448:Tnfsf15 UTSW 4 63745068 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GGAACCAGTTGTTGCTTATTTCAC -3'
(R):5'- CAAGACTTTATTCTGATACCACAGG -3'

Sequencing Primer
(F):5'- CACAGACTTGGACCCTGTTAGTAG -3'
(R):5'- CACAGGTATCAAAACCAGAGGTTCTG -3'
Posted On 2015-09-25