Incidental Mutation 'R4665:Dcaf10'
Institutional Source Beutler Lab
Gene Symbol Dcaf10
Ensembl Gene ENSMUSG00000035572
Gene NameDDB1 and CUL4 associated factor 10
MMRRC Submission 041923-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4665 (G1)
Quality Score225
Status Validated
Chromosomal Location45342101-45379759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45372769 bp
Amino Acid Change Arginine to Glutamine at position 394 (R394Q)
Ref Sequence ENSEMBL: ENSMUSP00000117082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153803] [ENSMUST00000155551]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130821
Predicted Effect probably benign
Transcript: ENSMUST00000153803
SMART Domains Protein: ENSMUSP00000121616
Gene: ENSMUSG00000035572

Blast:WD40 1 30 3e-11 BLAST
Blast:WD40 127 165 2e-10 BLAST
WD40 183 222 1.31e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000155551
AA Change: R394Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117082
Gene: ENSMUSG00000035572
AA Change: R394Q

low complexity region 15 46 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
WD40 166 203 1.71e1 SMART
WD40 206 245 7.85e-7 SMART
WD40 249 288 2.59e-7 SMART
WD40 295 334 2.05e1 SMART
low complexity region 352 374 N/A INTRINSIC
Blast:WD40 468 506 3e-10 BLAST
WD40 524 563 1.31e-3 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (89/90)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,925,077 M76K probably null Het
Abcc4 A G 14: 118,529,002 I886T probably benign Het
Adam6a T C 12: 113,544,372 Y122H possibly damaging Het
Adgre1 A G 17: 57,480,947 T905A probably benign Het
Arap2 A G 5: 62,669,969 F969L possibly damaging Het
Arhgef4 G T 1: 34,806,032 G1439V possibly damaging Het
Atm A G 9: 53,464,229 W2097R probably benign Het
Atmin A G 8: 116,957,959 D786G probably damaging Het
AU016765 T A 17: 64,519,921 noncoding transcript Het
Capn1 A T 19: 6,011,015 N253K probably benign Het
Cdc42bpa A G 1: 180,144,565 T527A probably damaging Het
Chmp7 A T 14: 69,720,955 V255D probably damaging Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Cpsf2 T C 12: 101,983,207 S61P probably damaging Het
Cpvl C T 6: 53,931,933 E282K probably benign Het
Crygn T A 5: 24,751,021 probably benign Het
Csde1 C T 3: 103,047,072 T386M probably damaging Het
Cux1 G A 5: 136,286,799 T1129I probably damaging Het
Dhx16 T C 17: 35,879,943 V11A probably damaging Het
Dnah10 T C 5: 124,828,472 M4060T possibly damaging Het
Duox1 C T 2: 122,319,475 P116S probably benign Het
Eif5b A G 1: 38,045,712 E880G probably damaging Het
Eml6 A T 11: 29,819,007 Y67* probably null Het
Faim2 C A 15: 99,524,700 probably null Het
Faim2 T G 15: 99,524,701 S72R probably benign Het
Fam103a1 C T 7: 81,768,430 R78W probably damaging Het
Fam160a1 A T 3: 85,730,681 W104R probably damaging Het
Fanca T C 8: 123,268,972 T1364A probably damaging Het
Gak A G 5: 108,582,960 I860T probably benign Het
Garem2 C A 5: 30,114,667 R376S probably damaging Het
Gdf2 A G 14: 33,945,451 T377A probably damaging Het
Gm2431 A T 7: 142,257,703 C155S unknown Het
Gm37596 G A 3: 93,692,469 H198Y probably damaging Het
Gm5814 A G 17: 47,410,363 M1V probably null Het
Gm5901 C G 7: 105,377,231 Q69E possibly damaging Het
Gm9945 A G 11: 53,480,375 probably benign Het
Gmps T C 3: 64,001,535 V486A probably benign Het
Gtf2ird1 T A 5: 134,383,902 E55V probably damaging Het
Hoxa11 T A 6: 52,243,503 N267Y probably damaging Het
Ifngr2 C A 16: 91,560,038 H153Q possibly damaging Het
Ift172 G T 5: 31,285,254 Q190K possibly damaging Het
Iqch A G 9: 63,445,571 V899A probably damaging Het
Lactb2 T C 1: 13,647,400 E133G probably damaging Het
Lig3 G A 11: 82,800,250 V110M probably damaging Het
Lin54 C A 5: 100,453,084 Q262H possibly damaging Het
Lingo3 G A 10: 80,835,538 T186I probably damaging Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Ly86 T A 13: 37,375,034 F70I probably damaging Het
Mospd2 A T X: 164,947,333 S301T probably benign Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Myo15 A T 11: 60,504,879 probably null Het
Nme8 C G 13: 19,674,435 A78P probably damaging Het
Obscn C T 11: 59,124,752 V965M probably damaging Het
Olfr1122 T A 2: 87,387,876 I57K probably damaging Het
Parn T C 16: 13,541,103 K592E probably benign Het
Pax6 C A 2: 105,683,998 probably benign Het
Pdcd6 A T 13: 74,317,206 M1K probably null Het
Pex11b T C 3: 96,643,835 L198P possibly damaging Het
Phldb3 C T 7: 24,611,427 A28V probably benign Het
Pkn3 C A 2: 30,085,457 probably benign Het
Pknox1 T C 17: 31,595,326 probably null Het
Ptprg A C 14: 12,215,288 I1092L possibly damaging Het
Pxylp1 A C 9: 96,825,285 I281M probably damaging Het
Retreg2 G T 1: 75,144,666 L195F probably damaging Het
Rgs20 G C 1: 5,021,008 F66L probably benign Het
Ripk4 C T 16: 97,755,073 V157I probably damaging Het
Ryr2 T C 13: 11,750,685 probably null Het
Scaper A T 9: 55,912,055 S125R probably damaging Het
Sec16a C T 2: 26,412,958 probably benign Het
Slc35f6 T C 5: 30,655,613 L37P probably damaging Het
Slc6a12 T A 6: 121,359,013 probably benign Het
Slc9a5 A G 8: 105,368,128 K784E probably damaging Het
Snd1 T C 6: 28,707,054 V455A probably damaging Het
Ssbp2 A T 13: 91,539,335 I46L possibly damaging Het
Stil A G 4: 115,041,644 D1157G probably benign Het
Tax1bp1 T A 6: 52,737,131 C271S probably benign Het
Tdrd6 T A 17: 43,624,116 M2014L probably benign Het
Thsd7a T A 6: 12,337,314 T1235S possibly damaging Het
Thsd7a T A 6: 12,504,013 I381F possibly damaging Het
Tmprss11d T C 5: 86,309,401 D133G probably damaging Het
Tpr C T 1: 150,444,399 R2233W probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vgll1 A G X: 57,092,432 R54G possibly damaging Het
Wdr72 A G 9: 74,210,024 T673A probably benign Het
Zfp169 C T 13: 48,490,863 probably benign Het
Zfp319 G A 8: 95,325,573 probably benign Het
Other mutations in Dcaf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02431:Dcaf10 APN 4 45342630 missense probably benign 0.01
IGL02660:Dcaf10 APN 4 45372769 missense possibly damaging 0.92
R0048:Dcaf10 UTSW 4 45374262 nonsense probably null
R0550:Dcaf10 UTSW 4 45372753 missense probably benign
R0611:Dcaf10 UTSW 4 45373011 missense probably damaging 1.00
R2289:Dcaf10 UTSW 4 45359816 missense probably damaging 1.00
R2973:Dcaf10 UTSW 4 45373957 missense probably benign 0.04
R3610:Dcaf10 UTSW 4 45372962 nonsense probably null
R3735:Dcaf10 UTSW 4 45348117 missense probably benign 0.01
R4655:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4690:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4724:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4725:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4735:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4743:Dcaf10 UTSW 4 45370409 missense probably damaging 0.98
R5220:Dcaf10 UTSW 4 45373909 missense possibly damaging 0.94
R5254:Dcaf10 UTSW 4 45370415 missense possibly damaging 0.94
R5855:Dcaf10 UTSW 4 45342558 missense probably benign 0.18
R6833:Dcaf10 UTSW 4 45373043 missense probably damaging 1.00
R7132:Dcaf10 UTSW 4 45342391 missense probably benign
R7345:Dcaf10 UTSW 4 45342583 missense probably damaging 0.98
R7366:Dcaf10 UTSW 4 45373919 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-10-08