Incidental Mutation 'R4751:Dnajc11'
ID 357572
Institutional Source Beutler Lab
Gene Symbol Dnajc11
Ensembl Gene ENSMUSG00000039768
Gene Name DnaJ heat shock protein family (Hsp40) member C11
Synonyms E030019A03Rik
MMRRC Submission 041970-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R4751 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 152018177-152066416 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 152052999 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 141 (R141H)
Ref Sequence ENSEMBL: ENSMUSP00000119604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062904] [ENSMUST00000139069] [ENSMUST00000147625]
AlphaFold Q5U458
Predicted Effect probably benign
Transcript: ENSMUST00000062904
AA Change: R141H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000051643
Gene: ENSMUSG00000039768
AA Change: R141H

DomainStartEndE-ValueType
DnaJ 13 74 4.41e-24 SMART
low complexity region 102 122 N/A INTRINSIC
Pfam:DUF3395 410 549 2e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138738
Predicted Effect probably benign
Transcript: ENSMUST00000139069
AA Change: R141H

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000119604
Gene: ENSMUSG00000039768
AA Change: R141H

DomainStartEndE-ValueType
DnaJ 13 74 4.41e-24 SMART
low complexity region 102 122 N/A INTRINSIC
coiled coil region 318 349 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142198
Predicted Effect probably benign
Transcript: ENSMUST00000147625
AA Change: R103H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122140
Gene: ENSMUSG00000039768
AA Change: R103H

DomainStartEndE-ValueType
DnaJ 1 36 2.51e-1 SMART
low complexity region 64 84 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148048
Meta Mutation Damage Score 0.0736 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 95% (124/131)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation exhibit motor neuron pathology, disorganized cristae and lymphoid abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A T 7: 127,836,258 (GRCm39) C112S probably benign Het
Abca13 G A 11: 9,227,973 (GRCm39) probably null Het
Abca14 A G 7: 119,911,400 (GRCm39) E1328G probably benign Het
Abca9 T A 11: 110,021,396 (GRCm39) I1105F probably benign Het
Abr T C 11: 76,347,434 (GRCm39) N396D possibly damaging Het
Aftph A C 11: 20,677,074 (GRCm39) C178W probably damaging Het
Akr1c14 T C 13: 4,115,338 (GRCm39) F89S possibly damaging Het
Ank3 C T 10: 69,822,036 (GRCm39) A1518V probably benign Het
Arfgap2 T G 2: 91,097,713 (GRCm39) S143R probably benign Het
Aspdh T A 7: 44,116,629 (GRCm39) C107* probably null Het
Asphd2 C A 5: 112,539,612 (GRCm39) G74W probably damaging Het
AU040320 G A 4: 126,748,259 (GRCm39) probably null Het
B3glct T A 5: 149,648,867 (GRCm39) probably null Het
Bcl9l A G 9: 44,418,100 (GRCm39) K646R probably damaging Het
Brat1 T G 5: 140,704,051 (GRCm39) L768R probably damaging Het
Btbd18 T A 2: 84,498,265 (GRCm39) Y634* probably null Het
Bub1 T A 2: 127,665,858 (GRCm39) probably benign Het
Carns1 A T 19: 4,216,417 (GRCm39) D588E probably damaging Het
Cast T C 13: 74,894,166 (GRCm39) K141E probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Chsy3 T C 18: 59,308,872 (GRCm39) S42P possibly damaging Het
Clca3a1 A T 3: 144,710,609 (GRCm39) F865I possibly damaging Het
Clec4f T A 6: 83,622,264 (GRCm39) M526L possibly damaging Het
Clnk T C 5: 38,878,256 (GRCm39) E301G probably benign Het
Colgalt2 T A 1: 152,365,627 (GRCm39) I309N probably benign Het
Cyp2e1 A T 7: 140,354,629 (GRCm39) K326* probably null Het
Dagla T A 19: 10,227,758 (GRCm39) T717S probably benign Het
Dst A G 1: 34,230,965 (GRCm39) K2853E probably benign Het
Eif4g1 A G 16: 20,505,265 (GRCm39) K1208E possibly damaging Het
Elane A G 10: 79,722,625 (GRCm39) R48G probably benign Het
Fbxo30 T A 10: 11,165,939 (GRCm39) N220K probably benign Het
Fbxo33 A T 12: 59,247,714 (GRCm39) probably benign Het
Fetub G A 16: 22,756,645 (GRCm39) V169I probably benign Het
Gpx6 A C 13: 21,501,234 (GRCm39) Q107H probably damaging Het
H2bc18 A T 3: 96,176,467 (GRCm39) probably benign Het
Homer3 A T 8: 70,738,084 (GRCm39) I19F probably damaging Het
Hspa4 C T 11: 53,175,026 (GRCm39) V144I probably benign Het
Icos C T 1: 61,032,876 (GRCm39) S25L probably benign Het
Ifna4 A G 4: 88,760,185 (GRCm39) T30A probably benign Het
Ino80b C T 6: 83,101,731 (GRCm39) G46D probably damaging Het
Kpna2 T G 11: 106,883,490 (GRCm39) I100L possibly damaging Het
Krt71 C T 15: 101,643,901 (GRCm39) G446R probably damaging Het
Krtap31-2 A G 11: 99,827,402 (GRCm39) N78S possibly damaging Het
Lman1 A G 18: 66,131,505 (GRCm39) S132P probably benign Het
Lmna T C 3: 88,393,840 (GRCm39) Q246R possibly damaging Het
Lrp10 T A 14: 54,706,049 (GRCm39) V413E probably damaging Het
Macf1 A C 4: 123,365,443 (GRCm39) I1541S probably benign Het
Med24 A G 11: 98,597,258 (GRCm39) L874P probably damaging Het
Mgll T A 6: 88,702,093 (GRCm39) probably benign Het
Mrpl37 A T 4: 106,914,672 (GRCm39) L364Q probably damaging Het
Mrpl47 C T 3: 32,782,590 (GRCm39) R209H probably benign Het
Muc5ac T C 7: 141,371,338 (GRCm39) F3285L probably benign Het
Mylk A G 16: 34,699,539 (GRCm39) R301G probably benign Het
Nacad A G 11: 6,555,726 (GRCm39) L8P unknown Het
Ncf1 T A 5: 134,258,399 (GRCm39) H8L probably damaging Het
Ncoa3 T A 2: 165,911,823 (GRCm39) M1383K possibly damaging Het
Necab2 C T 8: 120,194,337 (GRCm39) S271L probably benign Het
Nme8 A T 13: 19,859,808 (GRCm39) probably null Het
Nsrp1 T G 11: 76,967,545 (GRCm39) T16P possibly damaging Het
Obox3 A T 7: 15,359,617 (GRCm39) probably null Het
Or1l8 T C 2: 36,817,595 (GRCm39) H177R probably damaging Het
Or4c108 A G 2: 88,803,477 (GRCm39) C253R probably damaging Het
Or4c15 T A 2: 88,760,258 (GRCm39) I134F probably damaging Het
Or4d6 T A 19: 12,086,541 (GRCm39) Y123F probably damaging Het
Or52n2b A T 7: 104,565,617 (GRCm39) Y295* probably null Het
Or6b2 C A 1: 92,407,705 (GRCm39) A213S probably benign Het
Osbpl3 C G 6: 50,277,977 (GRCm39) E790Q possibly damaging Het
Osmr A T 15: 6,872,333 (GRCm39) W254R probably damaging Het
Otoa T C 7: 120,732,147 (GRCm39) probably benign Het
Pagr1a A T 7: 126,614,551 (GRCm39) L218H probably damaging Het
Pcdha11 G A 18: 37,139,997 (GRCm39) G542D probably damaging Het
Pck2 T A 14: 55,780,018 (GRCm39) I54N probably damaging Het
Ppif T C 14: 25,699,923 (GRCm39) V173A probably damaging Het
Ptgs2 T A 1: 149,979,771 (GRCm39) L292H probably damaging Het
Ptpru A G 4: 131,529,897 (GRCm39) S604P probably damaging Het
Qrfpr T C 3: 36,236,771 (GRCm39) H210R possibly damaging Het
Rasgrf1 A G 9: 89,792,171 (GRCm39) T41A probably damaging Het
Rasgrf1 A G 9: 89,894,919 (GRCm39) H1113R probably damaging Het
Rhoc T A 3: 104,699,963 (GRCm39) I80N probably damaging Het
Riok3 A G 18: 12,287,040 (GRCm39) N472S probably benign Het
Rnf213 A G 11: 119,336,571 (GRCm39) Y3314C probably benign Het
Shank2 C T 7: 143,963,205 (GRCm39) T264I probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Sipa1l1 A G 12: 82,387,968 (GRCm39) I65V probably benign Het
Slc22a19 T C 19: 7,668,510 (GRCm39) K291R possibly damaging Het
Slc22a20 T C 19: 6,030,488 (GRCm39) I315V probably benign Het
Slc44a1 A T 4: 53,560,973 (GRCm39) D563V probably damaging Het
Smchd1 A T 17: 71,698,463 (GRCm39) H1104Q probably benign Het
Spcs2 A T 7: 99,493,976 (GRCm39) probably null Het
Speer1e T A 5: 11,236,458 (GRCm39) Y138N probably damaging Het
Sptb T C 12: 76,673,884 (GRCm39) E301G probably benign Het
Stum T C 1: 180,270,234 (GRCm39) D86G probably damaging Het
Sufu A T 19: 46,472,088 (GRCm39) D449V probably benign Het
Sun5 T C 2: 153,707,936 (GRCm39) probably null Het
Tbc1d15 T A 10: 115,038,492 (GRCm39) I574F probably damaging Het
Tert G A 13: 73,776,182 (GRCm39) S311N possibly damaging Het
Tiparp T C 3: 65,460,225 (GRCm39) Y507H probably damaging Het
Tnk2 T C 16: 32,498,675 (GRCm39) C158R probably damaging Het
Tpgs1 T C 10: 79,511,454 (GRCm39) S199P possibly damaging Het
Trdmt1 G T 2: 13,549,464 (GRCm39) probably benign Het
Trp53bp1 T A 2: 121,058,290 (GRCm39) D944V probably damaging Het
Tsc1 T A 2: 28,569,093 (GRCm39) I720N probably damaging Het
Ttn T C 2: 76,539,949 (GRCm39) T34346A probably benign Het
Ttn T C 2: 76,727,925 (GRCm39) probably benign Het
Uba7 T A 9: 107,857,004 (GRCm39) C686S possibly damaging Het
Ush2a T A 1: 188,582,284 (GRCm39) F3782L probably damaging Het
Vars2 A T 17: 35,970,235 (GRCm39) H745Q possibly damaging Het
Vgf T A 5: 137,061,255 (GRCm39) D472E probably damaging Het
Vmn2r15 T C 5: 109,434,620 (GRCm39) M695V probably benign Het
Vps41 A T 13: 18,995,792 (GRCm39) D208V probably damaging Het
Vta1 C T 10: 14,531,560 (GRCm39) A272T probably benign Het
Wnk4 G A 11: 101,167,188 (GRCm39) probably benign Het
Zfp507 T C 7: 35,493,807 (GRCm39) K412R probably damaging Het
Zfp768 A G 7: 126,943,934 (GRCm39) F65L possibly damaging Het
Zfp956 T C 6: 47,940,510 (GRCm39) S290P probably benign Het
Other mutations in Dnajc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Dnajc11 APN 4 152,063,759 (GRCm39) missense probably damaging 0.99
IGL02253:Dnajc11 APN 4 152,034,976 (GRCm39) nonsense probably null
IGL02606:Dnajc11 APN 4 152,063,941 (GRCm39) missense probably benign 0.18
IGL02969:Dnajc11 APN 4 152,062,503 (GRCm39) missense probably benign 0.33
IGL03062:Dnajc11 APN 4 152,055,318 (GRCm39) missense possibly damaging 0.92
PIT4812001:Dnajc11 UTSW 4 152,037,346 (GRCm39) missense probably benign 0.04
R0601:Dnajc11 UTSW 4 152,054,393 (GRCm39) missense probably damaging 1.00
R0620:Dnajc11 UTSW 4 152,058,085 (GRCm39) missense possibly damaging 0.54
R0639:Dnajc11 UTSW 4 152,054,393 (GRCm39) missense probably damaging 1.00
R1694:Dnajc11 UTSW 4 152,063,730 (GRCm39) missense probably damaging 1.00
R4091:Dnajc11 UTSW 4 152,062,550 (GRCm39) unclassified probably benign
R4545:Dnajc11 UTSW 4 152,064,398 (GRCm39) missense probably damaging 1.00
R4548:Dnajc11 UTSW 4 152,058,074 (GRCm39) missense possibly damaging 0.93
R4720:Dnajc11 UTSW 4 152,052,996 (GRCm39) missense probably damaging 1.00
R4732:Dnajc11 UTSW 4 152,055,424 (GRCm39) unclassified probably benign
R4895:Dnajc11 UTSW 4 152,064,390 (GRCm39) missense probably damaging 1.00
R5122:Dnajc11 UTSW 4 152,061,454 (GRCm39) missense possibly damaging 0.63
R5127:Dnajc11 UTSW 4 152,054,271 (GRCm39) unclassified probably benign
R5174:Dnajc11 UTSW 4 152,064,441 (GRCm39) missense probably damaging 1.00
R5180:Dnajc11 UTSW 4 152,054,396 (GRCm39) missense probably damaging 1.00
R5319:Dnajc11 UTSW 4 152,052,983 (GRCm39) missense probably damaging 1.00
R5624:Dnajc11 UTSW 4 152,063,967 (GRCm39) missense probably benign
R6056:Dnajc11 UTSW 4 152,062,583 (GRCm39) unclassified probably benign
R6434:Dnajc11 UTSW 4 152,063,751 (GRCm39) missense probably damaging 1.00
R7635:Dnajc11 UTSW 4 152,053,068 (GRCm39) missense probably damaging 1.00
R7652:Dnajc11 UTSW 4 152,058,682 (GRCm39) missense probably damaging 0.99
R7937:Dnajc11 UTSW 4 152,034,909 (GRCm39) missense probably damaging 1.00
R7940:Dnajc11 UTSW 4 152,053,045 (GRCm39) missense probably benign 0.00
R8093:Dnajc11 UTSW 4 152,054,357 (GRCm39) missense probably damaging 1.00
R8361:Dnajc11 UTSW 4 152,055,368 (GRCm39) missense probably damaging 0.99
R8684:Dnajc11 UTSW 4 152,065,183 (GRCm39) makesense probably null
R9608:Dnajc11 UTSW 4 152,034,978 (GRCm39) missense possibly damaging 0.94
Z1176:Dnajc11 UTSW 4 152,018,240 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACCTGTGACATTGATGCTG -3'
(R):5'- CCTCAGTGGCTAATTGCAGG -3'

Sequencing Primer
(F):5'- ACATTGATGCTGTGTGGGC -3'
(R):5'- GCTTTCATAGAGATGAGGCTCACC -3'
Posted On 2015-11-11