Incidental Mutation 'R4766:Cct3'
ID366124
Institutional Source Beutler Lab
Gene Symbol Cct3
Ensembl Gene ENSMUSG00000001416
Gene Namechaperonin containing Tcp1, subunit 3 (gamma)
SynonymsCctg, Tcp1-rs3, TriC-P5
MMRRC Submission 042407-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4766 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location88297116-88321767 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 88311785 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 241 (L241*)
Ref Sequence ENSEMBL: ENSMUSP00000131113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001452] [ENSMUST00000164166] [ENSMUST00000168062]
Predicted Effect probably null
Transcript: ENSMUST00000001452
AA Change: L241*
SMART Domains Protein: ENSMUSP00000001452
Gene: ENSMUSG00000001416
AA Change: L241*

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 33 527 3.2e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163735
SMART Domains Protein: ENSMUSP00000130616
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 2 115 4.7e-22 PFAM
Pfam:Cpn60_TCP1 106 306 8.4e-64 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164166
AA Change: L203*
SMART Domains Protein: ENSMUSP00000126109
Gene: ENSMUSG00000001416
AA Change: L203*

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 15 489 1.7e-144 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167718
Predicted Effect probably null
Transcript: ENSMUST00000168062
AA Change: L241*
SMART Domains Protein: ENSMUSP00000131113
Gene: ENSMUSG00000001416
AA Change: L241*

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 33 520 2.3e-157 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants have been characterized for this gene. In addition, a pseudogene of this gene has been found on chromosome 8. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit lethality at E8. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,097,636 V1584I probably benign Het
A430105I19Rik C A 2: 118,759,577 R262L probably damaging Het
Adamts12 A G 15: 11,285,901 D732G probably benign Het
Agpat4 A G 17: 12,151,750 probably benign Het
AI182371 T C 2: 35,095,817 D140G possibly damaging Het
Apol11b T A 15: 77,634,933 T316S probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bard1 T C 1: 71,075,174 E216G probably benign Het
Bdp1 C A 13: 100,049,868 R1692L probably damaging Het
Capn10 T C 1: 92,943,419 I101T probably damaging Het
Ccdc175 C T 12: 72,112,205 M653I probably benign Het
Ccr8 G A 9: 120,094,464 C215Y probably damaging Het
Cd2ap A T 17: 42,852,459 I25N probably damaging Het
Cdh19 T C 1: 110,893,260 K583E probably benign Het
Cela3a A G 4: 137,402,675 S212P unknown Het
Cfap44 T A 16: 44,415,883 probably null Het
Clca3a1 A T 3: 144,749,712 L440Q probably damaging Het
Crybg2 A G 4: 134,089,352 Y1676C probably damaging Het
Dscam T C 16: 96,643,988 D1501G probably benign Het
Eml6 C A 11: 29,805,757 L832F probably benign Het
Enpp3 A G 10: 24,773,927 L867P probably damaging Het
Erbb3 A G 10: 128,586,238 Y46H possibly damaging Het
Fads3 T C 19: 10,056,020 I342T possibly damaging Het
Flvcr1 A T 1: 191,021,106 S290T probably benign Het
Fut9 A G 4: 25,799,191 probably benign Het
Gad2 C T 2: 22,622,667 A2V probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Herc1 T G 9: 66,441,929 D2023E probably benign Het
Hsd3b3 A G 3: 98,742,485 L174P probably damaging Het
Impg2 TACCACCACCACCACCACCACCACCA TACCACCACCACCACCACCACCA 16: 56,257,939 probably benign Het
Iqcf3 A G 9: 106,560,949 probably null Het
Kcna4 G A 2: 107,296,543 V541M probably damaging Het
Kcnj11 T C 7: 46,099,816 T28A probably benign Het
Kcnmb2 T A 3: 32,181,867 N88K probably damaging Het
Kdm2a TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCTTCCTCCTCCTC 19: 4,324,507 probably benign Het
Krt2 T C 15: 101,813,960 E430G probably damaging Het
Lins1 C T 7: 66,710,641 L384F possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mfge8 T C 7: 79,134,525 N389D probably damaging Het
Mug1 C T 6: 121,884,254 T1278I probably benign Het
Myh9 T C 15: 77,807,877 M161V probably damaging Het
Myl7 T A 11: 5,898,171 Y61F probably benign Het
Nlrp4d A T 7: 10,362,779 unknown Het
Nol3 A G 8: 105,281,933 probably null Het
Nup85 T A 11: 115,577,925 probably null Het
Obscn T A 11: 59,012,742 T7619S probably damaging Het
Olfr1298 T C 2: 111,645,881 M39V probably benign Het
Olfr331 T A 11: 58,501,668 N296I probably damaging Het
Olfr628 C T 7: 103,732,250 T108I possibly damaging Het
Olfr844 G A 9: 19,318,845 V104I probably benign Het
Pax5 T A 4: 44,679,494 I184F probably damaging Het
Pcdha7 T A 18: 36,974,507 V195D probably damaging Het
Phf3 A T 1: 30,813,939 probably benign Het
Pla2g15 G T 8: 106,163,071 G325V probably damaging Het
Ppp1r21 T C 17: 88,572,615 F487L probably benign Het
Ppp1r9a A G 6: 5,157,016 I965V probably benign Het
Ptpru A G 4: 131,820,964 V74A probably damaging Het
Rif1 T A 2: 52,098,934 Y780N probably damaging Het
Rps25 T A 9: 44,408,749 Y23N possibly damaging Het
Ryr1 T C 7: 29,085,833 D1811G probably damaging Het
Scamp5 T G 9: 57,452,036 probably null Het
Senp1 T C 15: 98,045,896 D602G probably damaging Het
Sh2b2 T G 5: 136,231,957 D135A probably damaging Het
Slc26a8 G A 17: 28,638,661 T836M probably benign Het
Slfn4 T G 11: 83,186,821 I145S possibly damaging Het
Spag6l G A 16: 16,777,390 T377I probably benign Het
Spdye4b T C 5: 143,196,334 F129S probably damaging Het
Sspo G A 6: 48,470,580 G2360E probably benign Het
Taar2 A T 10: 23,940,771 I70F probably damaging Het
Taar7e A G 10: 24,038,566 N318S probably damaging Het
Tor1a C A 2: 30,967,730 R42L probably benign Het
Trdn A T 10: 33,474,506 Q690H probably benign Het
Trim56 C A 5: 137,112,725 V646L probably benign Het
Tspan15 T A 10: 62,191,544 K165I probably benign Het
Usp24 A G 4: 106,416,048 Y2210C probably damaging Het
Usp45 A G 4: 21,797,307 T76A probably damaging Het
Vps13c T A 9: 67,878,224 probably null Het
Zfp512b T C 2: 181,585,095 probably benign Het
Zyx C A 6: 42,356,159 probably null Het
Other mutations in Cct3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0068:Cct3 UTSW 3 88318465 missense probably benign 0.05
R0068:Cct3 UTSW 3 88318465 missense probably benign 0.05
R0454:Cct3 UTSW 3 88302866 critical splice donor site probably null
R0799:Cct3 UTSW 3 88299345 unclassified probably null
R0883:Cct3 UTSW 3 88313557 missense probably damaging 1.00
R1202:Cct3 UTSW 3 88318528 critical splice donor site probably null
R3889:Cct3 UTSW 3 88321027 missense probably benign 0.00
R5089:Cct3 UTSW 3 88300843 missense probably damaging 1.00
R5224:Cct3 UTSW 3 88297225 utr 5 prime probably benign
R5263:Cct3 UTSW 3 88321365 critical splice donor site probably null
R5772:Cct3 UTSW 3 88300967 missense probably damaging 1.00
R6026:Cct3 UTSW 3 88311722 missense possibly damaging 0.90
R7230:Cct3 UTSW 3 88313260 missense probably damaging 0.99
R7423:Cct3 UTSW 3 88309196 missense probably benign 0.05
R7810:Cct3 UTSW 3 88321135 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCTGTATCATCAGTTCCAG -3'
(R):5'- CACAGAAATTCACTGTCTTGAAAGG -3'

Sequencing Primer
(F):5'- GTATCATCAGTTCCAGTTACTGTG -3'
(R):5'- GGTGGCCCACAACTATCTGTAATG -3'
Posted On2015-12-21