Incidental Mutation 'R4766:Kdm2a'
ID366192
Institutional Source Beutler Lab
Gene Symbol Kdm2a
Ensembl Gene ENSMUSG00000054611
Gene Namelysine (K)-specific demethylase 2A
SynonymsGm4560, lalina, Fbl7, Jhdm1a, Cxxc8, Fbxl11, 5530401A10Rik
MMRRC Submission 042407-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R4766 (G1)
Quality Score107
Status Validated
Chromosome19
Chromosomal Location4314419-4398285 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC to TTCCTCCTCCTCCTCTTCCTCCTCCTC at 4324507 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047898] [ENSMUST00000075856] [ENSMUST00000176497] [ENSMUST00000176653]
Predicted Effect probably benign
Transcript: ENSMUST00000047898
SMART Domains Protein: ENSMUSP00000047683
Gene: ENSMUSG00000054611

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
JmjC 148 316 1.52e-34 SMART
low complexity region 416 433 N/A INTRINSIC
PDB:2YU2|A 440 517 1e-35 PDB
Pfam:zf-CXXC 563 609 7.5e-16 PFAM
PHD 619 676 3.25e-4 SMART
low complexity region 848 875 N/A INTRINSIC
FBOX 892 932 1.58e-2 SMART
low complexity region 987 998 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075856
SMART Domains Protein: ENSMUSP00000076698
Gene: ENSMUSG00000054611

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
JmjC 148 316 1.52e-34 SMART
low complexity region 416 433 N/A INTRINSIC
PDB:2YU2|A 440 517 1e-35 PDB
Pfam:zf-CXXC 563 609 7.5e-16 PFAM
PHD 619 676 3.25e-4 SMART
low complexity region 848 875 N/A INTRINSIC
FBOX 892 932 1.58e-2 SMART
low complexity region 987 998 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175978
Predicted Effect probably benign
Transcript: ENSMUST00000176497
SMART Domains Protein: ENSMUSP00000135471
Gene: ENSMUSG00000054611

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176532
Predicted Effect probably benign
Transcript: ENSMUST00000176653
SMART Domains Protein: ENSMUSP00000135745
Gene: ENSMUSG00000054611

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
PDB:2YU2|A 52 77 4e-7 PDB
Pfam:zf-CXXC 123 169 3e-16 PFAM
PHD 179 236 3.25e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains at least six highly degenerated leucine-rich repeats. This family member plays a role in epigenetic silencing. It nucleates at CpG islands and specifically demethylates both mono- and di-methylated lysine-36 of histone H3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show embryonic lethality, severe growth retardation, reduced neuron proliferation, increased neuron apoptosis, impaired neuron differentiation, small hearts, abnormal cardiac looping and, in some cases, incomplete embryonic turning and neural tube closure defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,097,636 V1584I probably benign Het
A430105I19Rik C A 2: 118,759,577 R262L probably damaging Het
Adamts12 A G 15: 11,285,901 D732G probably benign Het
Agpat4 A G 17: 12,151,750 probably benign Het
AI182371 T C 2: 35,095,817 D140G possibly damaging Het
Apol11b T A 15: 77,634,933 T316S probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bard1 T C 1: 71,075,174 E216G probably benign Het
Bdp1 C A 13: 100,049,868 R1692L probably damaging Het
Capn10 T C 1: 92,943,419 I101T probably damaging Het
Ccdc175 C T 12: 72,112,205 M653I probably benign Het
Ccr8 G A 9: 120,094,464 C215Y probably damaging Het
Cct3 T A 3: 88,311,785 L241* probably null Het
Cd2ap A T 17: 42,852,459 I25N probably damaging Het
Cdh19 T C 1: 110,893,260 K583E probably benign Het
Cela3a A G 4: 137,402,675 S212P unknown Het
Cfap44 T A 16: 44,415,883 probably null Het
Clca3a1 A T 3: 144,749,712 L440Q probably damaging Het
Crybg2 A G 4: 134,089,352 Y1676C probably damaging Het
Dscam T C 16: 96,643,988 D1501G probably benign Het
Eml6 C A 11: 29,805,757 L832F probably benign Het
Enpp3 A G 10: 24,773,927 L867P probably damaging Het
Erbb3 A G 10: 128,586,238 Y46H possibly damaging Het
Fads3 T C 19: 10,056,020 I342T possibly damaging Het
Flvcr1 A T 1: 191,021,106 S290T probably benign Het
Fut9 A G 4: 25,799,191 probably benign Het
Gad2 C T 2: 22,622,667 A2V probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Herc1 T G 9: 66,441,929 D2023E probably benign Het
Hsd3b3 A G 3: 98,742,485 L174P probably damaging Het
Impg2 TACCACCACCACCACCACCACCACCA TACCACCACCACCACCACCACCA 16: 56,257,939 probably benign Het
Iqcf3 A G 9: 106,560,949 probably null Het
Kcna4 G A 2: 107,296,543 V541M probably damaging Het
Kcnj11 T C 7: 46,099,816 T28A probably benign Het
Kcnmb2 T A 3: 32,181,867 N88K probably damaging Het
Krt2 T C 15: 101,813,960 E430G probably damaging Het
Lins1 C T 7: 66,710,641 L384F possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mfge8 T C 7: 79,134,525 N389D probably damaging Het
Mug1 C T 6: 121,884,254 T1278I probably benign Het
Myh9 T C 15: 77,807,877 M161V probably damaging Het
Myl7 T A 11: 5,898,171 Y61F probably benign Het
Nlrp4d A T 7: 10,362,779 unknown Het
Nol3 A G 8: 105,281,933 probably null Het
Nup85 T A 11: 115,577,925 probably null Het
Obscn T A 11: 59,012,742 T7619S probably damaging Het
Olfr1298 T C 2: 111,645,881 M39V probably benign Het
Olfr331 T A 11: 58,501,668 N296I probably damaging Het
Olfr628 C T 7: 103,732,250 T108I possibly damaging Het
Olfr844 G A 9: 19,318,845 V104I probably benign Het
Pax5 T A 4: 44,679,494 I184F probably damaging Het
Pcdha7 T A 18: 36,974,507 V195D probably damaging Het
Phf3 A T 1: 30,813,939 probably benign Het
Pla2g15 G T 8: 106,163,071 G325V probably damaging Het
Ppp1r21 T C 17: 88,572,615 F487L probably benign Het
Ppp1r9a A G 6: 5,157,016 I965V probably benign Het
Ptpru A G 4: 131,820,964 V74A probably damaging Het
Rif1 T A 2: 52,098,934 Y780N probably damaging Het
Rps25 T A 9: 44,408,749 Y23N possibly damaging Het
Ryr1 T C 7: 29,085,833 D1811G probably damaging Het
Scamp5 T G 9: 57,452,036 probably null Het
Senp1 T C 15: 98,045,896 D602G probably damaging Het
Sh2b2 T G 5: 136,231,957 D135A probably damaging Het
Slc26a8 G A 17: 28,638,661 T836M probably benign Het
Slfn4 T G 11: 83,186,821 I145S possibly damaging Het
Spag6l G A 16: 16,777,390 T377I probably benign Het
Spdye4b T C 5: 143,196,334 F129S probably damaging Het
Sspo G A 6: 48,470,580 G2360E probably benign Het
Taar2 A T 10: 23,940,771 I70F probably damaging Het
Taar7e A G 10: 24,038,566 N318S probably damaging Het
Tor1a C A 2: 30,967,730 R42L probably benign Het
Trdn A T 10: 33,474,506 Q690H probably benign Het
Trim56 C A 5: 137,112,725 V646L probably benign Het
Tspan15 T A 10: 62,191,544 K165I probably benign Het
Usp24 A G 4: 106,416,048 Y2210C probably damaging Het
Usp45 A G 4: 21,797,307 T76A probably damaging Het
Vps13c T A 9: 67,878,224 probably null Het
Zfp512b T C 2: 181,585,095 probably benign Het
Zyx C A 6: 42,356,159 probably null Het
Other mutations in Kdm2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Kdm2a APN 19 4356898 missense possibly damaging 0.94
IGL00679:Kdm2a APN 19 4326841 missense probably damaging 1.00
IGL01104:Kdm2a APN 19 4356738 splice site probably benign
IGL01161:Kdm2a APN 19 4319251 missense probably benign 0.04
IGL01433:Kdm2a APN 19 4342860 missense possibly damaging 0.83
IGL01456:Kdm2a APN 19 4351755 missense probably damaging 1.00
IGL01467:Kdm2a APN 19 4324407 missense probably damaging 0.99
IGL01517:Kdm2a APN 19 4362061 splice site probably benign
IGL01528:Kdm2a APN 19 4343055 missense probably benign 0.18
IGL02504:Kdm2a APN 19 4356771 missense possibly damaging 0.92
IGL02895:Kdm2a APN 19 4362902 missense probably damaging 1.00
IGL03109:Kdm2a APN 19 4329107 missense probably benign 0.04
IGL03171:Kdm2a APN 19 4356764 missense probably damaging 1.00
IGL03256:Kdm2a APN 19 4345510 unclassified probably benign
BB009:Kdm2a UTSW 19 4319156 missense probably damaging 0.98
BB019:Kdm2a UTSW 19 4319156 missense probably damaging 0.98
P0027:Kdm2a UTSW 19 4343245 splice site probably benign
PIT4382001:Kdm2a UTSW 19 4343173 missense probably benign
R0220:Kdm2a UTSW 19 4324919 missense possibly damaging 0.85
R0961:Kdm2a UTSW 19 4329191 missense probably benign 0.07
R1662:Kdm2a UTSW 19 4328212 missense probably damaging 1.00
R2023:Kdm2a UTSW 19 4322464 missense probably damaging 0.98
R2191:Kdm2a UTSW 19 4356931 splice site probably null
R2207:Kdm2a UTSW 19 4362870 missense probably damaging 1.00
R2351:Kdm2a UTSW 19 4329126 missense probably benign 0.02
R2406:Kdm2a UTSW 19 4322518 missense probably damaging 1.00
R2882:Kdm2a UTSW 19 4331184 critical splice donor site probably null
R3788:Kdm2a UTSW 19 4351805 missense probably damaging 0.99
R3792:Kdm2a UTSW 19 4324512 missense possibly damaging 0.91
R3950:Kdm2a UTSW 19 4343232 missense possibly damaging 0.89
R4235:Kdm2a UTSW 19 4322521 missense probably damaging 0.98
R4377:Kdm2a UTSW 19 4329054 missense probably benign 0.01
R4466:Kdm2a UTSW 19 4320300 missense probably damaging 0.99
R4824:Kdm2a UTSW 19 4362787 missense probably damaging 1.00
R4838:Kdm2a UTSW 19 4325026 missense probably benign 0.41
R5283:Kdm2a UTSW 19 4331269 missense probably benign 0.00
R6366:Kdm2a UTSW 19 4324932 missense probably benign 0.15
R6368:Kdm2a UTSW 19 4350317 missense probably damaging 1.00
R6522:Kdm2a UTSW 19 4324826 missense possibly damaging 0.49
R6716:Kdm2a UTSW 19 4329102 missense probably damaging 1.00
R6757:Kdm2a UTSW 19 4319243 missense probably damaging 0.98
R6912:Kdm2a UTSW 19 4322501 missense probably benign 0.06
R6996:Kdm2a UTSW 19 4345641 missense probably benign 0.16
R7090:Kdm2a UTSW 19 4319141 missense probably damaging 1.00
R7497:Kdm2a UTSW 19 4324376 missense probably damaging 1.00
R7542:Kdm2a UTSW 19 4333830 start gained probably benign
R7932:Kdm2a UTSW 19 4319156 missense probably damaging 0.98
R8199:Kdm2a UTSW 19 4389026 missense unknown
R8263:Kdm2a UTSW 19 4324364 missense possibly damaging 0.88
R8446:Kdm2a UTSW 19 4356888 nonsense probably null
RF046:Kdm2a UTSW 19 4324507 unclassified probably benign
X0028:Kdm2a UTSW 19 4320271 missense possibly damaging 0.77
X0028:Kdm2a UTSW 19 4348746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATATCAAGGTGCACATAGAAGCCC -3'
(R):5'- AAAGAGCTCCACGGGACATC -3'

Sequencing Primer
(F):5'- GTGCACATAGAAGCCCTGTCAC -3'
(R):5'- GACATCCATTGTGCCCAAGCTG -3'
Posted On2015-12-21