Incidental Mutation 'R4849:Guca1a'
ID373428
Institutional Source Beutler Lab
Gene Symbol Guca1a
Ensembl Gene ENSMUSG00000023982
Gene Nameguanylate cyclase activator 1a (retina)
SynonymsmGCAP1, Guca1
MMRRC Submission 042461-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R4849 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location47394560-47400584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47394737 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 177 (T177A)
Ref Sequence ENSEMBL: ENSMUSP00000060027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024774] [ENSMUST00000059348] [ENSMUST00000145462]
Predicted Effect probably benign
Transcript: ENSMUST00000024774
SMART Domains Protein: ENSMUSP00000024774
Gene: ENSMUSG00000023979

DomainStartEndE-ValueType
EFh 57 85 6.35e-4 SMART
EFh 93 121 3.65e-4 SMART
EFh 146 174 5.83e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000059348
AA Change: T177A

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000060027
Gene: ENSMUSG00000023982
AA Change: T177A

DomainStartEndE-ValueType
EFh 55 83 3.01e-5 SMART
EFh 91 119 2.44e-5 SMART
EFh 135 163 5.83e-3 SMART
low complexity region 166 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145462
SMART Domains Protein: ENSMUSP00000126799
Gene: ENSMUSG00000023979

DomainStartEndE-ValueType
EFh 57 85 6.35e-4 SMART
EFh 93 121 3.65e-4 SMART
low complexity region 180 190 N/A INTRINSIC
Meta Mutation Damage Score 0.0670 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: This gene encodes a calcium-binding photoreceptor protein. The encoded protein may be involved in modulation of guanylyl cyclase activity, and in turn, the mammalian cone phototransduction cascade. Disruption of this gene results in the retinal degeneration associated with cone dystrophy. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele exhibit photoreceptor degeneration and loss of cone and rod function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G T 7: 28,615,452 R239S possibly damaging Het
Angptl1 C A 1: 156,857,165 N301K probably benign Het
Ankrd26 T A 6: 118,532,296 T603S probably benign Het
App T C 16: 85,056,434 D252G unknown Het
Atxn3 A G 12: 101,934,368 S219P probably benign Het
Birc6 T C 17: 74,647,388 S3397P probably damaging Het
Bivm A G 1: 44,142,873 I414V possibly damaging Het
Cemip A G 7: 83,935,737 F1324L possibly damaging Het
Ckap5 T A 2: 91,615,271 N1724K probably damaging Het
Corin T A 5: 72,302,835 M1035L probably damaging Het
Ctnna3 T C 10: 64,873,315 I711T probably damaging Het
Cts6 A T 13: 61,201,601 W98R probably null Het
Dip2a A G 10: 76,294,533 S580P probably damaging Het
Dock6 A G 9: 21,811,772 probably null Het
Dusp15 T A 2: 152,949,082 T32S probably damaging Het
Eogt T A 6: 97,116,055 N387I probably damaging Het
Evx2 T C 2: 74,659,331 D29G probably benign Het
Fat1 A G 8: 45,012,970 N1422S probably benign Het
Fat2 T C 11: 55,310,637 D537G probably damaging Het
Fat3 A C 9: 16,377,948 I93S probably benign Het
Fem1b T C 9: 62,797,294 E228G probably damaging Het
Fh1 A G 1: 175,620,506 T25A probably benign Het
Fndc3b A G 3: 27,459,948 W695R probably damaging Het
Gaa G A 11: 119,272,987 V222I possibly damaging Het
Ggnbp1 T C 17: 27,032,973 probably null Het
Gipc1 A G 8: 83,662,127 Y154C probably benign Het
Gm5356 G T 8: 89,187,042 noncoding transcript Het
Gnl1 T A 17: 35,987,711 probably null Het
Gpcpd1 C T 2: 132,534,099 G605R probably damaging Het
Ifit1bl1 T C 19: 34,594,676 E127G probably damaging Het
Ift81 A T 5: 122,591,219 I350N probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Ing4 A G 6: 125,043,983 R23G probably damaging Het
Ins1 A G 19: 52,264,946 N108S probably damaging Het
Iqce A T 5: 140,693,459 M72K possibly damaging Het
Itga3 C A 11: 95,076,271 M22I probably benign Het
Kctd18 T C 1: 57,961,993 E201G probably damaging Het
Klc1 A G 12: 111,781,695 N344S probably damaging Het
Klrb1f A T 6: 129,056,384 I192F probably damaging Het
Klrg2 A T 6: 38,630,279 probably null Het
Kntc1 A C 5: 123,759,065 I164L probably benign Het
Ltf T A 9: 111,025,990 I357K probably benign Het
Mr1 T C 1: 155,130,690 T304A probably benign Het
Msh6 C T 17: 87,983,519 R178C possibly damaging Het
Mtch1 T C 17: 29,347,591 D66G probably benign Het
Mtmr7 A G 8: 40,608,997 V15A probably benign Het
Mtss1l A T 8: 110,726,243 H40L possibly damaging Het
Mxra8 A G 4: 155,840,874 probably benign Het
Myo3b T C 2: 70,244,909 L535P probably damaging Het
Neurl2 T A 2: 164,832,819 probably null Het
Nfia A C 4: 98,081,811 T503P probably damaging Het
Noa1 T C 5: 77,306,332 E487G possibly damaging Het
Nuak1 A T 10: 84,375,279 V315D probably damaging Het
Nup205 A G 6: 35,230,570 N1519S possibly damaging Het
Olfr107 T C 17: 37,405,698 V50A probably benign Het
Olfr364-ps1 T C 2: 37,146,254 L14P probably damaging Het
Olfr417 T A 1: 174,369,400 I161K probably damaging Het
Olfr466 G A 13: 65,152,679 V152M possibly damaging Het
Olfr524 G T 7: 140,202,427 C114* probably null Het
Olfr585 A G 7: 103,098,319 I193V possibly damaging Het
Peli1 T A 11: 21,148,528 probably benign Het
Ppp6r1 A G 7: 4,643,207 L175P probably damaging Het
Prkcd A G 14: 30,599,743 L498P probably damaging Het
Prss30 T A 17: 23,972,795 I251F probably benign Het
Psme3 A T 11: 101,317,081 N21Y probably benign Het
Ptpra T C 2: 130,532,161 Y271H probably damaging Het
Ralgapa1 T A 12: 55,698,803 N1303Y probably damaging Het
Rims4 T C 2: 163,865,543 I121V probably benign Het
Rnf123 A T 9: 108,056,091 L1149Q probably damaging Het
Ryr3 T A 2: 112,908,462 L593F probably damaging Het
Sec23b T C 2: 144,585,599 F582S probably damaging Het
Sgpl1 T C 10: 61,104,518 K335R probably benign Het
Sirpa C T 2: 129,609,243 T141I probably damaging Het
Slit1 G T 19: 41,649,544 A270E probably benign Het
Snap91 T C 9: 86,792,560 T533A possibly damaging Het
Sphkap T G 1: 83,277,384 E881D probably benign Het
Sptan1 C A 2: 30,011,042 R1407S probably damaging Het
Tfdp1 A G 8: 13,373,895 T353A probably benign Het
Ttyh1 A G 7: 4,122,534 I62V possibly damaging Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Zfp398 T C 6: 47,859,512 I82T possibly damaging Het
Zp1 A G 19: 10,918,834 Y176H possibly damaging Het
Other mutations in Guca1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Guca1a APN 17 47400384 missense probably damaging 0.99
IGL01684:Guca1a APN 17 47395143 missense probably null 0.83
IGL01969:Guca1a APN 17 47400343 missense probably damaging 0.99
IGL02441:Guca1a APN 17 47394653 unclassified probably benign
IGL03273:Guca1a APN 17 47395173 missense probably benign 0.00
R1216:Guca1a UTSW 17 47395712 unclassified probably benign
R1666:Guca1a UTSW 17 47400242 missense probably damaging 1.00
R5433:Guca1a UTSW 17 47400370 missense probably damaging 0.99
R6996:Guca1a UTSW 17 47395177 missense probably benign 0.05
Z1088:Guca1a UTSW 17 47400410 missense probably benign
Z1176:Guca1a UTSW 17 47400410 missense probably benign
Z1177:Guca1a UTSW 17 47400410 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGAGACTCTGAGTTCAGGAG -3'
(R):5'- CCAGACTTTGGGTTCTGGATCC -3'

Sequencing Primer
(F):5'- AGACTCTGAGTTCAGGAGGTTCTATG -3'
(R):5'- GGATCCGTTATCACTGCCCCAG -3'
Posted On2016-03-01