Incidental Mutation 'R4849:Corin'
ID373377
Institutional Source Beutler Lab
Gene Symbol Corin
Ensembl Gene ENSMUSG00000005220
Gene Namecorin
SynonymsLrp4
MMRRC Submission 042461-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R4849 (G1)
Quality Score220
Status Validated
Chromosome5
Chromosomal Location72300025-72504473 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72302835 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1035 (M1035L)
Ref Sequence ENSEMBL: ENSMUSP00000005352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005352] [ENSMUST00000094710] [ENSMUST00000126664] [ENSMUST00000167460] [ENSMUST00000175766] [ENSMUST00000176974] [ENSMUST00000177290]
Predicted Effect probably damaging
Transcript: ENSMUST00000005352
AA Change: M1035L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005352
Gene: ENSMUSG00000005220
AA Change: M1035L

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
FRI 205 318 6.15e-11 SMART
LDLa 336 372 1.31e-8 SMART
LDLa 373 408 1.5e-8 SMART
LDLa 409 447 5.47e-11 SMART
LDLa 448 484 1.22e-8 SMART
low complexity region 508 521 N/A INTRINSIC
FRI 522 643 2.75e-31 SMART
LDLa 647 684 2.19e-10 SMART
LDLa 685 722 1.76e-5 SMART
LDLa 723 759 4.18e-7 SMART
SR 758 853 3.99e-10 SMART
Tryp_SPc 868 1097 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094710
SMART Domains Protein: ENSMUSP00000142749
Gene: ENSMUSG00000046808

DomainStartEndE-ValueType
SCOP:d1eula_ 5 180 9e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126664
SMART Domains Protein: ENSMUSP00000143594
Gene: ENSMUSG00000046808

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 111 176 1.2e-21 PFAM
Pfam:E1-E2_ATPase 181 450 3e-10 PFAM
low complexity region 523 534 N/A INTRINSIC
low complexity region 684 696 N/A INTRINSIC
Pfam:Cation_ATPase 739 859 3.4e-7 PFAM
Pfam:HAD 754 1114 1.3e-12 PFAM
Pfam:PhoLip_ATPase_C 1131 1376 4.3e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158570
Predicted Effect probably damaging
Transcript: ENSMUST00000167460
AA Change: M969L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127389
Gene: ENSMUSG00000005220
AA Change: M969L

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 342 1.5e-8 SMART
LDLa 343 381 5.47e-11 SMART
LDLa 382 418 1.22e-8 SMART
low complexity region 442 455 N/A INTRINSIC
FRI 456 577 2.75e-31 SMART
LDLa 581 618 2.19e-10 SMART
LDLa 619 656 1.76e-5 SMART
LDLa 657 693 4.18e-7 SMART
SR 692 787 3.99e-10 SMART
Tryp_SPc 802 1031 5.45e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175766
AA Change: M894L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135889
Gene: ENSMUSG00000005220
AA Change: M894L

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
FRI 137 250 6.15e-11 SMART
LDLa 268 304 1.31e-8 SMART
LDLa 305 343 2.07e-11 SMART
low complexity region 367 380 N/A INTRINSIC
FRI 381 502 2.75e-31 SMART
LDLa 506 543 2.19e-10 SMART
LDLa 544 581 1.76e-5 SMART
LDLa 582 618 4.18e-7 SMART
SR 617 712 3.99e-10 SMART
Tryp_SPc 727 956 5.45e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176974
AA Change: M932L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135722
Gene: ENSMUSG00000005220
AA Change: M932L

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 344 3.86e-11 SMART
LDLa 345 381 1.22e-8 SMART
low complexity region 405 418 N/A INTRINSIC
FRI 419 540 2.75e-31 SMART
LDLa 544 581 2.19e-10 SMART
LDLa 582 619 1.76e-5 SMART
LDLa 620 656 4.18e-7 SMART
SR 655 750 3.99e-10 SMART
Tryp_SPc 765 994 5.45e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177290
AA Change: M902L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135511
Gene: ENSMUSG00000005220
AA Change: M902L

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 72 185 6.15e-11 SMART
LDLa 203 239 1.31e-8 SMART
LDLa 240 275 1.5e-8 SMART
LDLa 276 314 5.47e-11 SMART
LDLa 315 351 1.22e-8 SMART
low complexity region 375 388 N/A INTRINSIC
FRI 389 510 2.75e-31 SMART
LDLa 514 551 2.19e-10 SMART
LDLa 552 589 1.76e-5 SMART
LDLa 590 626 4.18e-7 SMART
SR 625 720 3.99e-10 SMART
Tryp_SPc 735 964 5.45e-76 SMART
Meta Mutation Damage Score 0.3599 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display hypertension that is enhanced by high-salt diet and pregnancy, increased body weight, and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G T 7: 28,615,452 R239S possibly damaging Het
Angptl1 C A 1: 156,857,165 N301K probably benign Het
Ankrd26 T A 6: 118,532,296 T603S probably benign Het
App T C 16: 85,056,434 D252G unknown Het
Atxn3 A G 12: 101,934,368 S219P probably benign Het
Birc6 T C 17: 74,647,388 S3397P probably damaging Het
Bivm A G 1: 44,142,873 I414V possibly damaging Het
Cemip A G 7: 83,935,737 F1324L possibly damaging Het
Ckap5 T A 2: 91,615,271 N1724K probably damaging Het
Ctnna3 T C 10: 64,873,315 I711T probably damaging Het
Cts6 A T 13: 61,201,601 W98R probably null Het
Dip2a A G 10: 76,294,533 S580P probably damaging Het
Dock6 A G 9: 21,811,772 probably null Het
Dusp15 T A 2: 152,949,082 T32S probably damaging Het
Eogt T A 6: 97,116,055 N387I probably damaging Het
Evx2 T C 2: 74,659,331 D29G probably benign Het
Fat1 A G 8: 45,012,970 N1422S probably benign Het
Fat2 T C 11: 55,310,637 D537G probably damaging Het
Fat3 A C 9: 16,377,948 I93S probably benign Het
Fem1b T C 9: 62,797,294 E228G probably damaging Het
Fh1 A G 1: 175,620,506 T25A probably benign Het
Fndc3b A G 3: 27,459,948 W695R probably damaging Het
Gaa G A 11: 119,272,987 V222I possibly damaging Het
Ggnbp1 T C 17: 27,032,973 probably null Het
Gipc1 A G 8: 83,662,127 Y154C probably benign Het
Gm5356 G T 8: 89,187,042 noncoding transcript Het
Gnl1 T A 17: 35,987,711 probably null Het
Gpcpd1 C T 2: 132,534,099 G605R probably damaging Het
Guca1a T C 17: 47,394,737 T177A possibly damaging Het
Ifit1bl1 T C 19: 34,594,676 E127G probably damaging Het
Ift81 A T 5: 122,591,219 I350N probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Ing4 A G 6: 125,043,983 R23G probably damaging Het
Ins1 A G 19: 52,264,946 N108S probably damaging Het
Iqce A T 5: 140,693,459 M72K possibly damaging Het
Itga3 C A 11: 95,076,271 M22I probably benign Het
Kctd18 T C 1: 57,961,993 E201G probably damaging Het
Klc1 A G 12: 111,781,695 N344S probably damaging Het
Klrb1f A T 6: 129,056,384 I192F probably damaging Het
Klrg2 A T 6: 38,630,279 probably null Het
Kntc1 A C 5: 123,759,065 I164L probably benign Het
Ltf T A 9: 111,025,990 I357K probably benign Het
Mr1 T C 1: 155,130,690 T304A probably benign Het
Msh6 C T 17: 87,983,519 R178C possibly damaging Het
Mtch1 T C 17: 29,347,591 D66G probably benign Het
Mtmr7 A G 8: 40,608,997 V15A probably benign Het
Mtss1l A T 8: 110,726,243 H40L possibly damaging Het
Mxra8 A G 4: 155,840,874 probably benign Het
Myo3b T C 2: 70,244,909 L535P probably damaging Het
Neurl2 T A 2: 164,832,819 probably null Het
Nfia A C 4: 98,081,811 T503P probably damaging Het
Noa1 T C 5: 77,306,332 E487G possibly damaging Het
Nuak1 A T 10: 84,375,279 V315D probably damaging Het
Nup205 A G 6: 35,230,570 N1519S possibly damaging Het
Olfr107 T C 17: 37,405,698 V50A probably benign Het
Olfr364-ps1 T C 2: 37,146,254 L14P probably damaging Het
Olfr417 T A 1: 174,369,400 I161K probably damaging Het
Olfr466 G A 13: 65,152,679 V152M possibly damaging Het
Olfr524 G T 7: 140,202,427 C114* probably null Het
Olfr585 A G 7: 103,098,319 I193V possibly damaging Het
Peli1 T A 11: 21,148,528 probably benign Het
Ppp6r1 A G 7: 4,643,207 L175P probably damaging Het
Prkcd A G 14: 30,599,743 L498P probably damaging Het
Prss30 T A 17: 23,972,795 I251F probably benign Het
Psme3 A T 11: 101,317,081 N21Y probably benign Het
Ptpra T C 2: 130,532,161 Y271H probably damaging Het
Ralgapa1 T A 12: 55,698,803 N1303Y probably damaging Het
Rims4 T C 2: 163,865,543 I121V probably benign Het
Rnf123 A T 9: 108,056,091 L1149Q probably damaging Het
Ryr3 T A 2: 112,908,462 L593F probably damaging Het
Sec23b T C 2: 144,585,599 F582S probably damaging Het
Sgpl1 T C 10: 61,104,518 K335R probably benign Het
Sirpa C T 2: 129,609,243 T141I probably damaging Het
Slit1 G T 19: 41,649,544 A270E probably benign Het
Snap91 T C 9: 86,792,560 T533A possibly damaging Het
Sphkap T G 1: 83,277,384 E881D probably benign Het
Sptan1 C A 2: 30,011,042 R1407S probably damaging Het
Tfdp1 A G 8: 13,373,895 T353A probably benign Het
Ttyh1 A G 7: 4,122,534 I62V possibly damaging Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Zfp398 T C 6: 47,859,512 I82T possibly damaging Het
Zp1 A G 19: 10,918,834 Y176H possibly damaging Het
Other mutations in Corin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Corin APN 5 72304888 missense probably damaging 1.00
IGL01114:Corin APN 5 72305011 missense probably damaging 1.00
IGL01351:Corin APN 5 72338991 missense probably damaging 1.00
IGL01516:Corin APN 5 72454487 nonsense probably null
IGL01785:Corin APN 5 72339876 missense probably damaging 1.00
IGL01786:Corin APN 5 72339876 missense probably damaging 1.00
IGL01845:Corin APN 5 72353939 missense probably damaging 1.00
IGL02097:Corin APN 5 72372146 missense probably damaging 1.00
IGL02629:Corin APN 5 72332673 missense probably damaging 1.00
IGL03085:Corin APN 5 72353930 missense probably damaging 1.00
IGL03120:Corin APN 5 72360689 missense probably damaging 1.00
IGL03150:Corin APN 5 72302858 missense probably damaging 1.00
IGL03183:Corin APN 5 72301586 missense probably damaging 0.99
IGL03185:Corin APN 5 72332781 missense probably damaging 1.00
IGL03408:Corin APN 5 72342961 missense probably benign 0.40
alpaca UTSW 5 72503952 missense possibly damaging 0.85
R0078:Corin UTSW 5 72454473 missense possibly damaging 0.77
R0724:Corin UTSW 5 72332795 splice site probably benign
R1065:Corin UTSW 5 72301650 nonsense probably null
R1301:Corin UTSW 5 72304933 missense possibly damaging 0.81
R1466:Corin UTSW 5 72302790 critical splice donor site probably null
R1466:Corin UTSW 5 72302790 critical splice donor site probably null
R1520:Corin UTSW 5 72330895 missense probably damaging 1.00
R1584:Corin UTSW 5 72302790 critical splice donor site probably null
R1617:Corin UTSW 5 72503952 missense possibly damaging 0.85
R1912:Corin UTSW 5 72358403 missense probably damaging 1.00
R2059:Corin UTSW 5 72316051 missense possibly damaging 0.76
R2173:Corin UTSW 5 72504079 missense probably benign 0.01
R2242:Corin UTSW 5 72332711 missense probably damaging 1.00
R2373:Corin UTSW 5 72339038 missense probably damaging 1.00
R2850:Corin UTSW 5 72304955 missense probably damaging 1.00
R3683:Corin UTSW 5 72330855 missense probably damaging 1.00
R3684:Corin UTSW 5 72330855 missense probably damaging 1.00
R3790:Corin UTSW 5 72435298 missense probably benign 0.38
R3847:Corin UTSW 5 72422165 missense probably benign 0.13
R3926:Corin UTSW 5 72372130 missense probably damaging 1.00
R3939:Corin UTSW 5 72339879 missense possibly damaging 0.80
R3945:Corin UTSW 5 72358424 missense probably damaging 1.00
R4079:Corin UTSW 5 72503883 missense probably benign 0.03
R4224:Corin UTSW 5 72343108 missense probably damaging 1.00
R4473:Corin UTSW 5 72339057 missense probably damaging 1.00
R4585:Corin UTSW 5 72329699 missense probably damaging 1.00
R4586:Corin UTSW 5 72329699 missense probably damaging 1.00
R4926:Corin UTSW 5 72372182 missense probably damaging 1.00
R5080:Corin UTSW 5 72353851 intron probably benign
R5138:Corin UTSW 5 72339059 missense probably damaging 1.00
R5262:Corin UTSW 5 72304955 missense probably damaging 1.00
R5268:Corin UTSW 5 72343019 missense probably damaging 1.00
R5302:Corin UTSW 5 72316098 missense probably benign 0.07
R5307:Corin UTSW 5 72356978 missense probably damaging 1.00
R5324:Corin UTSW 5 72435257 missense probably damaging 1.00
R5352:Corin UTSW 5 72305033 missense probably benign 0.04
R5373:Corin UTSW 5 72304953 missense probably damaging 1.00
R5374:Corin UTSW 5 72304953 missense probably damaging 1.00
R5484:Corin UTSW 5 72358484 missense probably benign 0.15
R5502:Corin UTSW 5 72316106 nonsense probably null
R5544:Corin UTSW 5 72305014 nonsense probably null
R5682:Corin UTSW 5 72422154 missense possibly damaging 0.85
R5818:Corin UTSW 5 72435395 missense probably benign 0.00
R5992:Corin UTSW 5 72316389 missense probably benign 0.01
R6115:Corin UTSW 5 72360729 missense probably damaging 1.00
R6181:Corin UTSW 5 72372096 critical splice donor site probably null
R6317:Corin UTSW 5 72339045 missense probably damaging 1.00
R7053:Corin UTSW 5 72301527 missense probably benign 0.28
R7242:Corin UTSW 5 72305055 missense probably benign 0.14
R7452:Corin UTSW 5 72435247 missense possibly damaging 0.94
R7783:Corin UTSW 5 72301624 missense probably benign 0.26
R7903:Corin UTSW 5 72301500 missense probably benign 0.00
R7986:Corin UTSW 5 72301500 missense probably benign 0.00
R8007:Corin UTSW 5 72316103 missense probably damaging 0.96
Z1177:Corin UTSW 5 72454493 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGGAGATGGGTTGTCTCAAC -3'
(R):5'- AGGGAATTGATGTGCTTCTCTC -3'

Sequencing Primer
(F):5'- GGAGATGGGTTGTCTCAACTCTCC -3'
(R):5'- CTCGGTGTTATGAAAATATTCCTGC -3'
Posted On2016-03-01