Incidental Mutation 'R4849:Gaa'
ID373417
Institutional Source Beutler Lab
Gene Symbol Gaa
Ensembl Gene ENSMUSG00000025579
Gene Nameglucosidase, alpha, acid
SynonymsE430018M07Rik
MMRRC Submission 042461-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R4849 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location119267887-119285454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119272987 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 222 (V222I)
Ref Sequence ENSEMBL: ENSMUSP00000101865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026666] [ENSMUST00000106258] [ENSMUST00000106259] [ENSMUST00000132706]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026666
AA Change: V222I

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026666
Gene: ENSMUSG00000025579
AA Change: V222I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:Gal_mutarotas_2 254 320 3.7e-12 PFAM
Pfam:Glyco_hydro_31 340 825 8.8e-175 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106258
AA Change: V222I

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101865
Gene: ENSMUSG00000025579
AA Change: V222I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106259
AA Change: V222I

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101866
Gene: ENSMUSG00000025579
AA Change: V222I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:NtCtMGAM_N 147 253 3.5e-32 PFAM
Pfam:Gal_mutarotas_2 254 320 6.5e-12 PFAM
Pfam:Glyco_hydro_31 340 825 1.8e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128753
Predicted Effect probably benign
Transcript: ENSMUST00000132706
SMART Domains Protein: ENSMUSP00000119702
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 46 269 2.9e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143288
SMART Domains Protein: ENSMUSP00000121984
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 8 207 2.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150562
SMART Domains Protein: ENSMUSP00000115128
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 1 96 4.3e-28 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: This gene encodes a lysosomal acid glucosidase that is involved in the degradation of glycogen. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that cleaves alpha-1-4 and alpha-1-6 glycosidic bonds of glycogen, maltose and intermediate oligosaccharides within the lysosome. Mice lacking the encoded protein exhibit symptoms similar to human Pompe syndrome such as accumulation of glycogen in cardiac and skeletal muscle lysosomes resulting in reduced mobility and strength. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to massive glycogen accumulation in multiple organs, cardiomyopathy, hypoactivity, severe motor disability, profound muscle weakness and wasting, and progressive kyphosis. The age of onset and clinical course ofthe disease appear to be strain-dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G T 7: 28,615,452 R239S possibly damaging Het
Angptl1 C A 1: 156,857,165 N301K probably benign Het
Ankrd26 T A 6: 118,532,296 T603S probably benign Het
App T C 16: 85,056,434 D252G unknown Het
Atxn3 A G 12: 101,934,368 S219P probably benign Het
Birc6 T C 17: 74,647,388 S3397P probably damaging Het
Bivm A G 1: 44,142,873 I414V possibly damaging Het
Cemip A G 7: 83,935,737 F1324L possibly damaging Het
Ckap5 T A 2: 91,615,271 N1724K probably damaging Het
Corin T A 5: 72,302,835 M1035L probably damaging Het
Ctnna3 T C 10: 64,873,315 I711T probably damaging Het
Cts6 A T 13: 61,201,601 W98R probably null Het
Dip2a A G 10: 76,294,533 S580P probably damaging Het
Dock6 A G 9: 21,811,772 probably null Het
Dusp15 T A 2: 152,949,082 T32S probably damaging Het
Eogt T A 6: 97,116,055 N387I probably damaging Het
Evx2 T C 2: 74,659,331 D29G probably benign Het
Fat1 A G 8: 45,012,970 N1422S probably benign Het
Fat2 T C 11: 55,310,637 D537G probably damaging Het
Fat3 A C 9: 16,377,948 I93S probably benign Het
Fem1b T C 9: 62,797,294 E228G probably damaging Het
Fh1 A G 1: 175,620,506 T25A probably benign Het
Fndc3b A G 3: 27,459,948 W695R probably damaging Het
Ggnbp1 T C 17: 27,032,973 probably null Het
Gipc1 A G 8: 83,662,127 Y154C probably benign Het
Gm5356 G T 8: 89,187,042 noncoding transcript Het
Gnl1 T A 17: 35,987,711 probably null Het
Gpcpd1 C T 2: 132,534,099 G605R probably damaging Het
Guca1a T C 17: 47,394,737 T177A possibly damaging Het
Ifit1bl1 T C 19: 34,594,676 E127G probably damaging Het
Ift81 A T 5: 122,591,219 I350N probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Ing4 A G 6: 125,043,983 R23G probably damaging Het
Ins1 A G 19: 52,264,946 N108S probably damaging Het
Iqce A T 5: 140,693,459 M72K possibly damaging Het
Itga3 C A 11: 95,076,271 M22I probably benign Het
Kctd18 T C 1: 57,961,993 E201G probably damaging Het
Klc1 A G 12: 111,781,695 N344S probably damaging Het
Klrb1f A T 6: 129,056,384 I192F probably damaging Het
Klrg2 A T 6: 38,630,279 probably null Het
Kntc1 A C 5: 123,759,065 I164L probably benign Het
Ltf T A 9: 111,025,990 I357K probably benign Het
Mr1 T C 1: 155,130,690 T304A probably benign Het
Msh6 C T 17: 87,983,519 R178C possibly damaging Het
Mtch1 T C 17: 29,347,591 D66G probably benign Het
Mtmr7 A G 8: 40,608,997 V15A probably benign Het
Mtss1l A T 8: 110,726,243 H40L possibly damaging Het
Mxra8 A G 4: 155,840,874 probably benign Het
Myo3b T C 2: 70,244,909 L535P probably damaging Het
Neurl2 T A 2: 164,832,819 probably null Het
Nfia A C 4: 98,081,811 T503P probably damaging Het
Noa1 T C 5: 77,306,332 E487G possibly damaging Het
Nuak1 A T 10: 84,375,279 V315D probably damaging Het
Nup205 A G 6: 35,230,570 N1519S possibly damaging Het
Olfr107 T C 17: 37,405,698 V50A probably benign Het
Olfr364-ps1 T C 2: 37,146,254 L14P probably damaging Het
Olfr417 T A 1: 174,369,400 I161K probably damaging Het
Olfr466 G A 13: 65,152,679 V152M possibly damaging Het
Olfr524 G T 7: 140,202,427 C114* probably null Het
Olfr585 A G 7: 103,098,319 I193V possibly damaging Het
Peli1 T A 11: 21,148,528 probably benign Het
Ppp6r1 A G 7: 4,643,207 L175P probably damaging Het
Prkcd A G 14: 30,599,743 L498P probably damaging Het
Prss30 T A 17: 23,972,795 I251F probably benign Het
Psme3 A T 11: 101,317,081 N21Y probably benign Het
Ptpra T C 2: 130,532,161 Y271H probably damaging Het
Ralgapa1 T A 12: 55,698,803 N1303Y probably damaging Het
Rims4 T C 2: 163,865,543 I121V probably benign Het
Rnf123 A T 9: 108,056,091 L1149Q probably damaging Het
Ryr3 T A 2: 112,908,462 L593F probably damaging Het
Sec23b T C 2: 144,585,599 F582S probably damaging Het
Sgpl1 T C 10: 61,104,518 K335R probably benign Het
Sirpa C T 2: 129,609,243 T141I probably damaging Het
Slit1 G T 19: 41,649,544 A270E probably benign Het
Snap91 T C 9: 86,792,560 T533A possibly damaging Het
Sphkap T G 1: 83,277,384 E881D probably benign Het
Sptan1 C A 2: 30,011,042 R1407S probably damaging Het
Tfdp1 A G 8: 13,373,895 T353A probably benign Het
Ttyh1 A G 7: 4,122,534 I62V possibly damaging Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Zfp398 T C 6: 47,859,512 I82T possibly damaging Het
Zp1 A G 19: 10,918,834 Y176H possibly damaging Het
Other mutations in Gaa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Gaa APN 11 119274960 missense probably benign
IGL00780:Gaa APN 11 119274291 unclassified probably null
IGL00975:Gaa APN 11 119274683 missense possibly damaging 0.93
IGL01354:Gaa APN 11 119270568 missense probably benign 0.18
IGL01572:Gaa APN 11 119284177 missense probably benign
IGL01634:Gaa APN 11 119274076 missense possibly damaging 0.79
IGL01724:Gaa APN 11 119275121 missense possibly damaging 0.65
IGL01889:Gaa APN 11 119278297 missense probably benign 0.03
IGL02052:Gaa APN 11 119284195 missense possibly damaging 0.76
IGL02173:Gaa APN 11 119274913 missense probably damaging 1.00
IGL02261:Gaa APN 11 119281265 makesense probably null
IGL02337:Gaa APN 11 119277603 missense probably damaging 1.00
IGL02625:Gaa APN 11 119274733 missense probably damaging 1.00
IGL02818:Gaa APN 11 119276848 missense probably damaging 0.97
R0135:Gaa UTSW 11 119278890 missense probably benign 0.00
R0280:Gaa UTSW 11 119284547 missense probably damaging 1.00
R0479:Gaa UTSW 11 119281236 missense possibly damaging 0.95
R1130:Gaa UTSW 11 119274683 missense probably damaging 0.97
R1132:Gaa UTSW 11 119285059 missense probably damaging 0.99
R1146:Gaa UTSW 11 119274904 missense probably damaging 1.00
R1146:Gaa UTSW 11 119274904 missense probably damaging 1.00
R1179:Gaa UTSW 11 119281128 missense probably damaging 0.98
R1464:Gaa UTSW 11 119272984 missense probably benign 0.02
R1464:Gaa UTSW 11 119272984 missense probably benign 0.02
R1475:Gaa UTSW 11 119274316 splice site probably null
R1711:Gaa UTSW 11 119280460 missense probably damaging 1.00
R1817:Gaa UTSW 11 119284498 nonsense probably null
R1828:Gaa UTSW 11 119283272 missense probably damaging 0.99
R2013:Gaa UTSW 11 119284583 unclassified probably null
R2126:Gaa UTSW 11 119270282 nonsense probably null
R2179:Gaa UTSW 11 119275058 critical splice acceptor site probably null
R2496:Gaa UTSW 11 119283705 missense possibly damaging 0.53
R2936:Gaa UTSW 11 119283724 missense probably benign 0.02
R4321:Gaa UTSW 11 119270137 missense probably benign 0.20
R4603:Gaa UTSW 11 119278958 missense probably damaging 1.00
R5225:Gaa UTSW 11 119276843 missense probably damaging 1.00
R5643:Gaa UTSW 11 119280535 missense possibly damaging 0.96
R5644:Gaa UTSW 11 119280535 missense possibly damaging 0.96
R6074:Gaa UTSW 11 119284186 missense probably benign 0.07
R6154:Gaa UTSW 11 119278352 missense probably damaging 1.00
R6208:Gaa UTSW 11 119281171 missense probably benign 0.01
R6209:Gaa UTSW 11 119281171 missense probably benign 0.01
R6258:Gaa UTSW 11 119281171 missense probably benign 0.01
R6259:Gaa UTSW 11 119281171 missense probably benign 0.01
R6260:Gaa UTSW 11 119281171 missense probably benign 0.01
R7173:Gaa UTSW 11 119278991 missense probably damaging 1.00
R7211:Gaa UTSW 11 119284204 missense possibly damaging 0.80
R7379:Gaa UTSW 11 119283699 missense probably benign
R8011:Gaa UTSW 11 119272936 missense probably benign 0.00
X0064:Gaa UTSW 11 119274015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATCTCTCCAGCCCACGTA -3'
(R):5'- GTGGGGCCTAGCTCACTG -3'

Sequencing Primer
(F):5'- GCCCACGTAATTGTTTTAAGAAGCC -3'
(R):5'- TAACACCCTAGGGCTGGTAGTTC -3'
Posted On2016-03-01