Incidental Mutation 'R4863:Polr1g'
ID 374649
Institutional Source Beutler Lab
Gene Symbol Polr1g
Ensembl Gene ENSMUSG00000047649
Gene Name RNA polymerase I subunit G
Synonyms 2610103M17Rik, PAF49, Ase1, Cd3eap
MMRRC Submission 042473-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4863 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 19089939-19093408 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19091684 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 141 (Q141L)
Ref Sequence ENSEMBL: ENSMUSP00000044653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003645] [ENSMUST00000047036] [ENSMUST00000047621] [ENSMUST00000127785] [ENSMUST00000140836] [ENSMUST00000160369]
AlphaFold Q76KJ5
Predicted Effect probably benign
Transcript: ENSMUST00000003645
SMART Domains Protein: ENSMUSP00000003645
Gene: ENSMUSG00000003549

DomainStartEndE-ValueType
low complexity region 68 79 N/A INTRINSIC
Pfam:Rad10 100 213 2.9e-55 PFAM
HhH1 269 288 4.04e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000047036
AA Change: Q141L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044653
Gene: ENSMUSG00000047649
AA Change: Q141L

DomainStartEndE-ValueType
Pfam:RNA_polI_A34 37 397 7.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047621
SMART Domains Protein: ENSMUSP00000047839
Gene: ENSMUSG00000040734

DomainStartEndE-ValueType
coiled coil region 25 49 N/A INTRINSIC
low complexity region 349 370 N/A INTRINSIC
low complexity region 401 440 N/A INTRINSIC
low complexity region 453 472 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
low complexity region 575 600 N/A INTRINSIC
low complexity region 616 632 N/A INTRINSIC
ANK 655 684 2.25e-3 SMART
ANK 688 717 1.31e-4 SMART
SH3 757 815 4.66e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127785
SMART Domains Protein: ENSMUSP00000116351
Gene: ENSMUSG00000040734

DomainStartEndE-ValueType
coiled coil region 25 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140836
SMART Domains Protein: ENSMUSP00000114443
Gene: ENSMUSG00000040734

DomainStartEndE-ValueType
coiled coil region 25 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160192
Predicted Effect probably benign
Transcript: ENSMUST00000160369
SMART Domains Protein: ENSMUSP00000125655
Gene: ENSMUSG00000003549

DomainStartEndE-ValueType
low complexity region 68 79 N/A INTRINSIC
Pfam:Rad10 99 166 1.6e-34 PFAM
low complexity region 232 245 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176333
Predicted Effect probably benign
Transcript: ENSMUST00000177486
Meta Mutation Damage Score 0.2660 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (105/106)
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,210,658 (GRCm39) R190H probably benign Het
Abcc12 T A 8: 87,265,005 (GRCm39) I647F probably damaging Het
Acnat2 C A 4: 49,380,172 (GRCm39) W384L probably damaging Het
Acvr1 A G 2: 58,367,723 (GRCm39) L146P possibly damaging Het
Ankrd16 T A 2: 11,789,127 (GRCm39) M238K probably benign Het
Clmn A T 12: 104,763,353 (GRCm39) I91N probably damaging Het
Cog8 A T 8: 107,776,806 (GRCm39) L523H probably damaging Het
Cpxm2 T A 7: 131,661,476 (GRCm39) K437M probably benign Het
Dhx57 A T 17: 80,560,540 (GRCm39) V999E probably damaging Het
Dnpep T C 1: 75,285,874 (GRCm39) probably benign Het
Dok3 G A 13: 55,671,270 (GRCm39) R434W probably damaging Het
Dpysl5 C T 5: 30,941,687 (GRCm39) H275Y probably benign Het
Ednra A T 8: 78,394,012 (GRCm39) N361K probably damaging Het
Ei24 A T 9: 36,695,861 (GRCm39) S210R probably damaging Het
Erich3 T A 3: 154,470,441 (GRCm39) V158E unknown Het
Fam193a T A 5: 34,623,549 (GRCm39) V1379E possibly damaging Het
Fasn A G 11: 120,699,654 (GRCm39) V2304A probably damaging Het
Fcgbp A C 7: 27,785,769 (GRCm39) D402A probably benign Het
Fkbp14 T C 6: 54,562,930 (GRCm39) probably benign Het
Fnip1 G A 11: 54,406,382 (GRCm39) V1160I possibly damaging Het
Fsd2 T C 7: 81,202,712 (GRCm39) K289R probably null Het
Fuca2 A T 10: 13,381,651 (GRCm39) D188V probably damaging Het
Gfpt2 T C 11: 49,701,797 (GRCm39) V116A probably benign Het
Gm10770 T A 2: 150,020,816 (GRCm39) K234* probably null Het
Gm9887 A G 12: 69,418,763 (GRCm39) probably benign Het
Gtf3c2 A G 5: 31,316,577 (GRCm39) probably benign Het
H2-M10.3 T C 17: 36,677,528 (GRCm39) D250G probably damaging Het
Hapln4 G A 8: 70,537,142 (GRCm39) V26M possibly damaging Het
Hook3 G A 8: 26,528,057 (GRCm39) A611V probably damaging Het
Hr T C 14: 70,809,412 (GRCm39) L1141P probably damaging Het
Ifngr1 T C 10: 19,485,164 (GRCm39) S388P probably damaging Het
Itga3 T A 11: 94,952,793 (GRCm39) Q326L probably damaging Het
Itgb3 T A 11: 104,556,346 (GRCm39) I729N probably damaging Het
Kcnab2 A G 4: 152,486,403 (GRCm39) S132P probably damaging Het
Lama3 C T 18: 12,672,850 (GRCm39) A2481V probably damaging Het
Lama3 T C 18: 12,631,735 (GRCm39) probably benign Het
Lce1e A T 3: 92,615,178 (GRCm39) C56* probably null Het
Lmcd1 T C 6: 112,264,832 (GRCm39) probably benign Het
Lrrc14 T A 15: 76,597,562 (GRCm39) probably null Het
Lypd8l A T 11: 58,503,338 (GRCm39) probably null Het
Map4k5 G A 12: 69,865,212 (GRCm39) P591L probably benign Het
Mapk13 C A 17: 28,995,284 (GRCm39) D168E probably damaging Het
Marf1 A C 16: 13,950,529 (GRCm39) H952Q possibly damaging Het
Megf6 T C 4: 154,338,738 (GRCm39) probably null Het
Mical3 T C 6: 121,010,748 (GRCm39) I411M probably damaging Het
Myo5a A T 9: 75,124,789 (GRCm39) K1781N probably damaging Het
N4bp2 T C 5: 65,965,473 (GRCm39) V1174A probably benign Het
Ncdn A T 4: 126,644,216 (GRCm39) L202Q probably damaging Het
Ncor1 T A 11: 62,283,464 (GRCm39) M408L possibly damaging Het
Nf1 T C 11: 79,300,235 (GRCm39) L249P probably damaging Het
Nlrp9b T A 7: 19,783,521 (GRCm39) probably null Het
Nxpe3 A T 16: 55,669,996 (GRCm39) Y370N probably damaging Het
P2rx2 T A 5: 110,489,434 (GRCm39) T167S probably benign Het
Pcdhb19 G T 18: 37,632,161 (GRCm39) R652L probably benign Het
Pcdhga12 T C 18: 37,901,334 (GRCm39) L722P probably benign Het
Pde6a A T 18: 61,378,663 (GRCm39) I329F probably damaging Het
Pdpr T A 8: 111,828,583 (GRCm39) S29T probably benign Het
Pfkfb3 T C 2: 11,491,123 (GRCm39) D173G probably benign Het
Plcd4 A G 1: 74,604,961 (GRCm39) probably null Het
Pou2f2 A G 7: 24,796,533 (GRCm39) probably benign Het
Ppp1r14c TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGG 10: 3,316,702 (GRCm39) probably benign Het
Ppp1r42 T C 1: 10,073,611 (GRCm39) probably benign Het
Ptpre C T 7: 135,270,861 (GRCm39) H346Y probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rab12 A T 17: 66,805,103 (GRCm39) Y142N probably damaging Het
Rai14 A C 15: 10,572,556 (GRCm39) M857R probably damaging Het
Ranbp2 A G 10: 58,328,243 (GRCm39) K2753R probably damaging Het
Rasa4 A T 5: 136,132,765 (GRCm39) K6* probably null Het
Rasgef1a A G 6: 118,066,100 (GRCm39) M438V probably benign Het
Recql T G 6: 142,304,732 (GRCm39) probably benign Het
Rftn2 A G 1: 55,211,198 (GRCm39) V425A probably benign Het
Ror1 A G 4: 100,267,001 (GRCm39) Y234C probably damaging Het
Sap30l T A 11: 57,696,880 (GRCm39) L70Q probably damaging Het
Scn4a T C 11: 106,210,828 (GRCm39) R1730G probably damaging Het
Serinc5 T G 13: 92,827,488 (GRCm39) I268R probably damaging Het
Sin3b G A 8: 73,471,576 (GRCm39) V432I possibly damaging Het
Slc30a6 T C 17: 74,719,649 (GRCm39) M203T possibly damaging Het
Soat1 T C 1: 156,259,898 (GRCm39) N481S probably damaging Het
Sos2 G A 12: 69,686,928 (GRCm39) T206I probably benign Het
Sp100 G T 1: 85,632,724 (GRCm39) A132S probably benign Het
Sp140l1 C T 1: 85,066,521 (GRCm39) probably benign Het
Spata31d1c T A 13: 65,183,604 (GRCm39) L382* probably null Het
Stard9 T A 2: 120,531,341 (GRCm39) W2533R probably benign Het
Tas2r126 A G 6: 42,412,324 (GRCm39) T286A probably benign Het
Tedc2 T A 17: 24,436,910 (GRCm39) K275M probably damaging Het
Ten1 A T 11: 116,109,057 (GRCm39) K242N probably benign Het
Thoc2l A T 5: 104,665,616 (GRCm39) D46V possibly damaging Het
Tial1 C T 7: 128,056,752 (GRCm39) V1I probably damaging Het
Tle2 G A 10: 81,424,725 (GRCm39) R649H possibly damaging Het
Tmem178 A G 17: 81,252,374 (GRCm39) D86G probably benign Het
Trim29 T A 9: 43,240,872 (GRCm39) D528E possibly damaging Het
Vmn2r61 A T 7: 41,950,132 (GRCm39) T851S probably benign Het
Vmn2r72 T A 7: 85,399,806 (GRCm39) Q414H possibly damaging Het
Yars1 A T 4: 129,083,675 (GRCm39) probably benign Het
Yipf4 A G 17: 74,801,087 (GRCm39) Q135R probably damaging Het
Zfp341 G A 2: 154,487,786 (GRCm39) probably benign Het
Zfp426 T C 9: 20,381,334 (GRCm39) Y536C probably damaging Het
Zp2 T G 7: 119,734,995 (GRCm39) Y430S probably damaging Het
Other mutations in Polr1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02028:Polr1g APN 7 19,091,003 (GRCm39) missense probably damaging 1.00
IGL02472:Polr1g APN 7 19,093,030 (GRCm39) missense probably damaging 1.00
FR4548:Polr1g UTSW 7 19,091,169 (GRCm39) unclassified probably benign
R0544:Polr1g UTSW 7 19,093,066 (GRCm39) missense probably damaging 1.00
R0785:Polr1g UTSW 7 19,091,210 (GRCm39) missense probably benign 0.06
R1793:Polr1g UTSW 7 19,091,904 (GRCm39) missense possibly damaging 0.61
R4971:Polr1g UTSW 7 19,091,487 (GRCm39) missense probably benign
R6161:Polr1g UTSW 7 19,091,558 (GRCm39) missense possibly damaging 0.62
R7340:Polr1g UTSW 7 19,093,073 (GRCm39) missense probably benign 0.41
R8857:Polr1g UTSW 7 19,093,355 (GRCm39) unclassified probably benign
R9532:Polr1g UTSW 7 19,091,817 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCCTAGGTTACCCAAGGCTG -3'
(R):5'- TTAAGGGCAAACTGGATGGC -3'

Sequencing Primer
(F):5'- AGGTTACCCAAGGCTGTTTTTAC -3'
(R):5'- GCAAGAAGCACCGATACCG -3'
Posted On 2016-03-17