Incidental Mutation 'R4863:Pou2f2'
ID 374651
Institutional Source Beutler Lab
Gene Symbol Pou2f2
Ensembl Gene ENSMUSG00000008496
Gene Name POU domain, class 2, transcription factor 2
Synonyms Oct-2, Otf2, Oct2c, Oct2d, Otf-2, Oct2a, Oct2b
MMRRC Submission 042473-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4863 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 24790111-24879292 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to G at 24796533 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098679] [ENSMUST00000108413] [ENSMUST00000108415] [ENSMUST00000108416] [ENSMUST00000108417] [ENSMUST00000108418] [ENSMUST00000176408] [ENSMUST00000175774] [ENSMUST00000147146]
AlphaFold Q00196
Predicted Effect probably benign
Transcript: ENSMUST00000098679
SMART Domains Protein: ENSMUSP00000096276
Gene: ENSMUSG00000008496

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
low complexity region 142 158 N/A INTRINSIC
POU 201 275 7.65e-52 SMART
low complexity region 281 294 N/A INTRINSIC
HOX 303 365 3.8e-18 SMART
low complexity region 392 416 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
low complexity region 433 456 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108413
SMART Domains Protein: ENSMUSP00000104051
Gene: ENSMUSG00000008496

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 179 253 7.65e-52 SMART
low complexity region 259 272 N/A INTRINSIC
HOX 281 343 3.8e-18 SMART
low complexity region 373 400 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108415
SMART Domains Protein: ENSMUSP00000104053
Gene: ENSMUSG00000008496

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 195 269 7.65e-52 SMART
low complexity region 275 288 N/A INTRINSIC
HOX 297 359 3.8e-18 SMART
low complexity region 386 410 N/A INTRINSIC
low complexity region 416 426 N/A INTRINSIC
low complexity region 427 450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108416
SMART Domains Protein: ENSMUSP00000104054
Gene: ENSMUSG00000008496

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 81 97 N/A INTRINSIC
POU 140 214 7.65e-52 SMART
low complexity region 220 233 N/A INTRINSIC
HOX 242 304 3.8e-18 SMART
low complexity region 331 355 N/A INTRINSIC
low complexity region 361 371 N/A INTRINSIC
low complexity region 372 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108417
SMART Domains Protein: ENSMUSP00000104055
Gene: ENSMUSG00000008496

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
low complexity region 142 158 N/A INTRINSIC
POU 201 275 7.65e-52 SMART
low complexity region 281 294 N/A INTRINSIC
HOX 303 365 3.8e-18 SMART
low complexity region 392 416 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
low complexity region 433 456 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108418
SMART Domains Protein: ENSMUSP00000104056
Gene: ENSMUSG00000008496

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 179 253 7.65e-52 SMART
low complexity region 259 272 N/A INTRINSIC
HOX 281 343 3.8e-18 SMART
low complexity region 370 394 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 411 434 N/A INTRINSIC
low complexity region 490 509 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184150
Predicted Effect probably benign
Transcript: ENSMUST00000176408
SMART Domains Protein: ENSMUSP00000135326
Gene: ENSMUSG00000008496

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 195 269 7.65e-52 SMART
low complexity region 275 288 N/A INTRINSIC
HOX 297 359 3.8e-18 SMART
low complexity region 386 410 N/A INTRINSIC
low complexity region 416 426 N/A INTRINSIC
low complexity region 427 450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175774
SMART Domains Protein: ENSMUSP00000135075
Gene: ENSMUSG00000008496

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 179 253 7.65e-52 SMART
low complexity region 259 272 N/A INTRINSIC
HOX 281 343 3.8e-18 SMART
low complexity region 370 394 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 411 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147146
SMART Domains Protein: ENSMUSP00000118307
Gene: ENSMUSG00000008496

DomainStartEndE-ValueType
low complexity region 39 58 N/A INTRINSIC
SCOP:d1gkub1 89 123 2e-3 SMART
low complexity region 134 151 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (105/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a homeobox-containing transcription factor of the POU domain family. The encoded protein binds the octamer sequence 5'-ATTTGCAT-3', a common transcription factor binding site in immunoglobulin gene promoters. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous inactivation of this locus results in failed B cell maturation and death within hours of birth. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Gene trapped(2)

Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,210,658 (GRCm39) R190H probably benign Het
Abcc12 T A 8: 87,265,005 (GRCm39) I647F probably damaging Het
Acnat2 C A 4: 49,380,172 (GRCm39) W384L probably damaging Het
Acvr1 A G 2: 58,367,723 (GRCm39) L146P possibly damaging Het
Ankrd16 T A 2: 11,789,127 (GRCm39) M238K probably benign Het
Clmn A T 12: 104,763,353 (GRCm39) I91N probably damaging Het
Cog8 A T 8: 107,776,806 (GRCm39) L523H probably damaging Het
Cpxm2 T A 7: 131,661,476 (GRCm39) K437M probably benign Het
Dhx57 A T 17: 80,560,540 (GRCm39) V999E probably damaging Het
Dnpep T C 1: 75,285,874 (GRCm39) probably benign Het
Dok3 G A 13: 55,671,270 (GRCm39) R434W probably damaging Het
Dpysl5 C T 5: 30,941,687 (GRCm39) H275Y probably benign Het
Ednra A T 8: 78,394,012 (GRCm39) N361K probably damaging Het
Ei24 A T 9: 36,695,861 (GRCm39) S210R probably damaging Het
Erich3 T A 3: 154,470,441 (GRCm39) V158E unknown Het
Fam193a T A 5: 34,623,549 (GRCm39) V1379E possibly damaging Het
Fasn A G 11: 120,699,654 (GRCm39) V2304A probably damaging Het
Fcgbp A C 7: 27,785,769 (GRCm39) D402A probably benign Het
Fkbp14 T C 6: 54,562,930 (GRCm39) probably benign Het
Fnip1 G A 11: 54,406,382 (GRCm39) V1160I possibly damaging Het
Fsd2 T C 7: 81,202,712 (GRCm39) K289R probably null Het
Fuca2 A T 10: 13,381,651 (GRCm39) D188V probably damaging Het
Gfpt2 T C 11: 49,701,797 (GRCm39) V116A probably benign Het
Gm10770 T A 2: 150,020,816 (GRCm39) K234* probably null Het
Gm9887 A G 12: 69,418,763 (GRCm39) probably benign Het
Gtf3c2 A G 5: 31,316,577 (GRCm39) probably benign Het
H2-M10.3 T C 17: 36,677,528 (GRCm39) D250G probably damaging Het
Hapln4 G A 8: 70,537,142 (GRCm39) V26M possibly damaging Het
Hook3 G A 8: 26,528,057 (GRCm39) A611V probably damaging Het
Hr T C 14: 70,809,412 (GRCm39) L1141P probably damaging Het
Ifngr1 T C 10: 19,485,164 (GRCm39) S388P probably damaging Het
Itga3 T A 11: 94,952,793 (GRCm39) Q326L probably damaging Het
Itgb3 T A 11: 104,556,346 (GRCm39) I729N probably damaging Het
Kcnab2 A G 4: 152,486,403 (GRCm39) S132P probably damaging Het
Lama3 C T 18: 12,672,850 (GRCm39) A2481V probably damaging Het
Lama3 T C 18: 12,631,735 (GRCm39) probably benign Het
Lce1e A T 3: 92,615,178 (GRCm39) C56* probably null Het
Lmcd1 T C 6: 112,264,832 (GRCm39) probably benign Het
Lrrc14 T A 15: 76,597,562 (GRCm39) probably null Het
Lypd8l A T 11: 58,503,338 (GRCm39) probably null Het
Map4k5 G A 12: 69,865,212 (GRCm39) P591L probably benign Het
Mapk13 C A 17: 28,995,284 (GRCm39) D168E probably damaging Het
Marf1 A C 16: 13,950,529 (GRCm39) H952Q possibly damaging Het
Megf6 T C 4: 154,338,738 (GRCm39) probably null Het
Mical3 T C 6: 121,010,748 (GRCm39) I411M probably damaging Het
Myo5a A T 9: 75,124,789 (GRCm39) K1781N probably damaging Het
N4bp2 T C 5: 65,965,473 (GRCm39) V1174A probably benign Het
Ncdn A T 4: 126,644,216 (GRCm39) L202Q probably damaging Het
Ncor1 T A 11: 62,283,464 (GRCm39) M408L possibly damaging Het
Nf1 T C 11: 79,300,235 (GRCm39) L249P probably damaging Het
Nlrp9b T A 7: 19,783,521 (GRCm39) probably null Het
Nxpe3 A T 16: 55,669,996 (GRCm39) Y370N probably damaging Het
P2rx2 T A 5: 110,489,434 (GRCm39) T167S probably benign Het
Pcdhb19 G T 18: 37,632,161 (GRCm39) R652L probably benign Het
Pcdhga12 T C 18: 37,901,334 (GRCm39) L722P probably benign Het
Pde6a A T 18: 61,378,663 (GRCm39) I329F probably damaging Het
Pdpr T A 8: 111,828,583 (GRCm39) S29T probably benign Het
Pfkfb3 T C 2: 11,491,123 (GRCm39) D173G probably benign Het
Plcd4 A G 1: 74,604,961 (GRCm39) probably null Het
Polr1g T A 7: 19,091,684 (GRCm39) Q141L probably damaging Het
Ppp1r14c TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGG 10: 3,316,702 (GRCm39) probably benign Het
Ppp1r42 T C 1: 10,073,611 (GRCm39) probably benign Het
Ptpre C T 7: 135,270,861 (GRCm39) H346Y probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rab12 A T 17: 66,805,103 (GRCm39) Y142N probably damaging Het
Rai14 A C 15: 10,572,556 (GRCm39) M857R probably damaging Het
Ranbp2 A G 10: 58,328,243 (GRCm39) K2753R probably damaging Het
Rasa4 A T 5: 136,132,765 (GRCm39) K6* probably null Het
Rasgef1a A G 6: 118,066,100 (GRCm39) M438V probably benign Het
Recql T G 6: 142,304,732 (GRCm39) probably benign Het
Rftn2 A G 1: 55,211,198 (GRCm39) V425A probably benign Het
Ror1 A G 4: 100,267,001 (GRCm39) Y234C probably damaging Het
Sap30l T A 11: 57,696,880 (GRCm39) L70Q probably damaging Het
Scn4a T C 11: 106,210,828 (GRCm39) R1730G probably damaging Het
Serinc5 T G 13: 92,827,488 (GRCm39) I268R probably damaging Het
Sin3b G A 8: 73,471,576 (GRCm39) V432I possibly damaging Het
Slc30a6 T C 17: 74,719,649 (GRCm39) M203T possibly damaging Het
Soat1 T C 1: 156,259,898 (GRCm39) N481S probably damaging Het
Sos2 G A 12: 69,686,928 (GRCm39) T206I probably benign Het
Sp100 G T 1: 85,632,724 (GRCm39) A132S probably benign Het
Sp140l1 C T 1: 85,066,521 (GRCm39) probably benign Het
Spata31d1c T A 13: 65,183,604 (GRCm39) L382* probably null Het
Stard9 T A 2: 120,531,341 (GRCm39) W2533R probably benign Het
Tas2r126 A G 6: 42,412,324 (GRCm39) T286A probably benign Het
Tedc2 T A 17: 24,436,910 (GRCm39) K275M probably damaging Het
Ten1 A T 11: 116,109,057 (GRCm39) K242N probably benign Het
Thoc2l A T 5: 104,665,616 (GRCm39) D46V possibly damaging Het
Tial1 C T 7: 128,056,752 (GRCm39) V1I probably damaging Het
Tle2 G A 10: 81,424,725 (GRCm39) R649H possibly damaging Het
Tmem178 A G 17: 81,252,374 (GRCm39) D86G probably benign Het
Trim29 T A 9: 43,240,872 (GRCm39) D528E possibly damaging Het
Vmn2r61 A T 7: 41,950,132 (GRCm39) T851S probably benign Het
Vmn2r72 T A 7: 85,399,806 (GRCm39) Q414H possibly damaging Het
Yars1 A T 4: 129,083,675 (GRCm39) probably benign Het
Yipf4 A G 17: 74,801,087 (GRCm39) Q135R probably damaging Het
Zfp341 G A 2: 154,487,786 (GRCm39) probably benign Het
Zfp426 T C 9: 20,381,334 (GRCm39) Y536C probably damaging Het
Zp2 T G 7: 119,734,995 (GRCm39) Y430S probably damaging Het
Other mutations in Pou2f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pou2f2 APN 7 24,792,125 (GRCm39) nonsense probably null
IGL01420:Pou2f2 APN 7 24,792,377 (GRCm39) missense possibly damaging 0.79
IGL02219:Pou2f2 APN 7 24,797,107 (GRCm39) missense probably damaging 1.00
IGL03038:Pou2f2 APN 7 24,796,577 (GRCm39) missense probably damaging 1.00
IGL03173:Pou2f2 APN 7 24,799,371 (GRCm39) splice site probably benign
D3080:Pou2f2 UTSW 7 24,796,558 (GRCm39) splice site probably benign
R0347:Pou2f2 UTSW 7 24,797,126 (GRCm39) missense probably damaging 1.00
R0385:Pou2f2 UTSW 7 24,815,501 (GRCm39) nonsense probably null
R0842:Pou2f2 UTSW 7 24,796,355 (GRCm39) missense probably damaging 1.00
R1665:Pou2f2 UTSW 7 24,792,149 (GRCm39) missense possibly damaging 0.66
R1914:Pou2f2 UTSW 7 24,799,581 (GRCm39) missense possibly damaging 0.71
R1915:Pou2f2 UTSW 7 24,799,581 (GRCm39) missense possibly damaging 0.71
R4076:Pou2f2 UTSW 7 24,796,713 (GRCm39) missense probably damaging 0.98
R4811:Pou2f2 UTSW 7 24,797,111 (GRCm39) nonsense probably null
R5362:Pou2f2 UTSW 7 24,792,320 (GRCm39) missense probably benign 0.02
R5995:Pou2f2 UTSW 7 24,796,869 (GRCm39) missense probably damaging 1.00
R6605:Pou2f2 UTSW 7 24,793,006 (GRCm39) missense probably damaging 0.96
R7541:Pou2f2 UTSW 7 24,815,553 (GRCm39) missense probably benign 0.02
R7884:Pou2f2 UTSW 7 24,815,489 (GRCm39) missense probably benign 0.39
R8123:Pou2f2 UTSW 7 24,796,433 (GRCm39) missense possibly damaging 0.83
R8416:Pou2f2 UTSW 7 24,815,551 (GRCm39) nonsense probably null
R8499:Pou2f2 UTSW 7 24,799,623 (GRCm39) missense probably damaging 1.00
R8554:Pou2f2 UTSW 7 24,814,981 (GRCm39) intron probably benign
R9122:Pou2f2 UTSW 7 24,792,302 (GRCm39) missense probably benign
R9341:Pou2f2 UTSW 7 24,794,277 (GRCm39) missense possibly damaging 0.88
R9343:Pou2f2 UTSW 7 24,794,277 (GRCm39) missense possibly damaging 0.88
R9474:Pou2f2 UTSW 7 24,794,247 (GRCm39) missense probably benign 0.02
R9576:Pou2f2 UTSW 7 24,796,569 (GRCm39) missense probably benign 0.28
R9578:Pou2f2 UTSW 7 24,796,569 (GRCm39) missense probably benign 0.28
RF014:Pou2f2 UTSW 7 24,815,162 (GRCm39) missense unknown
Z1177:Pou2f2 UTSW 7 24,792,601 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGCCTTATGCCCTGACTC -3'
(R):5'- TGTCTGTGGATTCAAGCCTAC -3'

Sequencing Primer
(F):5'- ACATAGCCCCCTAGTTCTGGG -3'
(R):5'- TGTGGATTCAAGCCTACCCAGC -3'
Posted On 2016-03-17