Incidental Mutation 'R4923:Dennd4c'
ID 378761
Institutional Source Beutler Lab
Gene Symbol Dennd4c
Ensembl Gene ENSMUSG00000038024
Gene Name DENN/MADD domain containing 4C
Synonyms 1700065A05Rik
MMRRC Submission 042525-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4923 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 86748555-86850603 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86807538 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 743 (L743P)
Ref Sequence ENSEMBL: ENSMUSP00000123367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045512] [ENSMUST00000082026] [ENSMUST00000142837]
AlphaFold A6H8H2
Predicted Effect possibly damaging
Transcript: ENSMUST00000045512
AA Change: L743P

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039860
Gene: ENSMUSG00000038024
AA Change: L743P

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.15e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000082026
AA Change: L743P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080685
Gene: ENSMUSG00000038024
AA Change: L743P

DomainStartEndE-ValueType
internal_repeat_1 43 91 3.19e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
low complexity region 1724 1739 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142837
AA Change: L743P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123367
Gene: ENSMUSG00000038024
AA Change: L743P

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.68e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 934 952 N/A INTRINSIC
low complexity region 964 976 N/A INTRINSIC
low complexity region 996 1003 N/A INTRINSIC
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1328 1343 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1675 1690 N/A INTRINSIC
Meta Mutation Damage Score 0.1456 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 98% (107/109)
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,471,968 probably null Het
5830473C10Rik A G 5: 90,561,299 T23A probably benign Het
Aim2 A G 1: 173,459,806 D124G probably benign Het
Akr1c6 T C 13: 4,454,495 M293T probably damaging Het
Ankhd1 A G 18: 36,589,452 T343A probably damaging Het
Ano2 T C 6: 125,903,055 probably benign Het
Arfgap2 G A 2: 91,273,659 G353R probably damaging Het
Armc3 A G 2: 19,292,980 probably null Het
Armc4 C G 18: 7,181,787 D846H probably damaging Het
Atp11b T C 3: 35,835,379 probably null Het
BC037034 A T 5: 138,262,379 probably benign Het
Brd4 A G 17: 32,199,240 M13T probably benign Het
Btd T A 14: 31,662,087 M10K possibly damaging Het
C1s2 T C 6: 124,625,690 K515E probably benign Het
Cars A T 7: 143,569,850 Y455N probably damaging Het
Ccdc110 A G 8: 45,943,423 S784G probably benign Het
Chic2 A G 5: 75,011,211 probably benign Het
Chka A T 19: 3,892,105 probably null Het
Chrne A G 11: 70,615,275 I420T possibly damaging Het
Clstn1 T C 4: 149,645,029 V747A probably benign Het
Cobll1 A G 2: 65,099,258 S575P possibly damaging Het
Col6a6 A T 9: 105,788,948 L3Q probably damaging Het
Comtd1 A T 14: 21,848,745 probably benign Het
Cpsf2 T C 12: 101,981,984 V13A probably benign Het
Creb3l4 T A 3: 90,242,214 I115L probably benign Het
Cyp2j12 C T 4: 96,102,109 A407T possibly damaging Het
D11Wsu47e C A 11: 113,688,979 T400K probably benign Het
Ddr2 A G 1: 169,997,929 probably null Het
Egfl8 T C 17: 34,614,197 T192A probably benign Het
Elf3 A G 1: 135,256,735 probably benign Het
Etv3 T G 3: 87,535,916 L269R possibly damaging Het
Fah C A 7: 84,602,052 probably benign Het
Fam189a1 A G 7: 64,767,691 S322P probably benign Het
Fbll1 C A 11: 35,797,580 L285F probably benign Het
Fcrla A T 1: 170,921,113 F154I probably damaging Het
Fnip2 T A 3: 79,489,394 probably null Het
Focad T C 4: 88,196,846 probably benign Het
Gabrr1 T A 4: 33,162,820 I462N possibly damaging Het
Gnptab A G 10: 88,429,623 T366A probably benign Het
Hnrnpu G A 1: 178,331,452 probably benign Het
Il17ra T A 6: 120,477,445 V299E possibly damaging Het
Impg1 G A 9: 80,345,078 Q607* probably null Het
Impg1 T A 9: 80,345,545 E374V probably damaging Het
Itgax C T 7: 128,148,528 L1039F probably benign Het
Kcnk2 A T 1: 189,339,936 V65D probably damaging Het
Kif20b A C 19: 34,941,211 probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lama5 T G 2: 180,184,149 I2372L probably benign Het
Lilrb4a A G 10: 51,492,043 T85A possibly damaging Het
Mapk13 C A 17: 28,778,223 H330N probably benign Het
Mars C A 10: 127,296,680 probably benign Het
Mdga1 C A 17: 29,838,078 R818L probably damaging Het
Mdn1 T A 4: 32,671,608 L476Q possibly damaging Het
Mup21 T C 4: 62,147,965 E178G probably benign Het
Myg1 A G 15: 102,331,853 N38S probably benign Het
Ncam1 A T 9: 49,505,479 D837E probably benign Het
Ncam2 C T 16: 81,589,791 P686L possibly damaging Het
Nck2 T C 1: 43,461,071 probably benign Het
Nfya T C 17: 48,400,535 probably benign Het
Npat A G 9: 53,571,030 K1346R probably damaging Het
Olfr1245 T C 2: 89,575,679 T16A probably damaging Het
Olfr530 G T 7: 140,373,007 T201K probably benign Het
Olfr805 A G 10: 129,722,812 V244A probably benign Het
Pde7b G T 10: 20,413,127 Q325K probably damaging Het
Pla2r1 A T 2: 60,422,712 M1345K probably benign Het
Prkcz T C 4: 155,357,489 D62G probably damaging Het
Pros1 T A 16: 62,903,572 C228S possibly damaging Het
Ptprc A G 1: 138,078,498 M782T possibly damaging Het
Rcn1 T C 2: 105,389,173 D225G probably benign Het
Recql4 G A 15: 76,710,181 R46C probably damaging Het
Rnf220 C T 4: 117,489,600 R205Q possibly damaging Het
Samd13 T C 3: 146,662,747 D11G probably benign Het
Scp2d1 T A 2: 144,824,110 I123K probably benign Het
Skap1 A T 11: 96,754,044 Y311F probably damaging Het
Slc17a2 G A 13: 23,819,095 V243M probably benign Het
Slc2a10 T C 2: 165,514,756 I112T possibly damaging Het
Slc39a2 G A 14: 51,895,254 G218D probably damaging Het
Sos1 T C 17: 80,434,952 N382S probably benign Het
Spam1 C T 6: 24,796,656 T202I probably damaging Het
Tas2r138 T A 6: 40,612,886 Q142L possibly damaging Het
Tec T A 5: 72,782,022 R217* probably null Het
Tmeff2 T A 1: 50,930,645 V90D probably benign Het
Tmem119 T C 5: 113,795,344 Y132C probably damaging Het
Topbp1 A G 9: 103,312,836 I204V probably benign Het
Ttn A T 2: 76,770,888 I17001N probably damaging Het
Vit T A 17: 78,586,841 M224K probably benign Het
Vmn1r179 T G 7: 23,929,066 H227Q possibly damaging Het
Vmn1r84 T C 7: 12,361,816 N305D probably benign Het
Vmn2r61 A G 7: 42,267,096 N378D probably damaging Het
Vmn2r87 A G 10: 130,478,566 Y384H probably damaging Het
Wiz C T 17: 32,361,596 A294T probably benign Het
Xdh C A 17: 73,924,936 V260L possibly damaging Het
Xirp2 A G 2: 67,512,893 K1826R probably benign Het
Zfp445 A C 9: 122,852,293 I861R probably benign Het
Zfp691 T C 4: 119,170,802 T78A probably benign Het
Other mutations in Dennd4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Dennd4c APN 4 86805487 splice site probably benign
IGL01810:Dennd4c APN 4 86799551 missense possibly damaging 0.94
IGL02203:Dennd4c APN 4 86802936 missense probably benign 0.00
IGL02217:Dennd4c APN 4 86813799 missense probably benign
IGL02236:Dennd4c APN 4 86807435 missense possibly damaging 0.68
IGL02256:Dennd4c APN 4 86799541 missense probably damaging 0.96
IGL02396:Dennd4c APN 4 86825000 missense probably damaging 1.00
IGL02523:Dennd4c APN 4 86774253 unclassified probably benign
IGL02615:Dennd4c APN 4 86821467 missense probably benign 0.00
IGL03069:Dennd4c APN 4 86774437 nonsense probably null
IGL03116:Dennd4c APN 4 86788820 splice site probably benign
IGL03117:Dennd4c APN 4 86777903 missense possibly damaging 0.95
IGL03273:Dennd4c APN 4 86777796 missense probably damaging 1.00
IGL03329:Dennd4c APN 4 86777876 missense probably damaging 1.00
IGL03365:Dennd4c APN 4 86807426 critical splice acceptor site probably null
PIT4486001:Dennd4c UTSW 4 86799464 nonsense probably null
R0010:Dennd4c UTSW 4 86781577 missense probably damaging 1.00
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0092:Dennd4c UTSW 4 86781607 missense probably damaging 1.00
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0511:Dennd4c UTSW 4 86826022 missense probably damaging 1.00
R0515:Dennd4c UTSW 4 86813466 missense possibly damaging 0.94
R0578:Dennd4c UTSW 4 86812422 missense probably damaging 1.00
R0759:Dennd4c UTSW 4 86788829 missense probably damaging 1.00
R0784:Dennd4c UTSW 4 86844908 missense probably benign 0.37
R1156:Dennd4c UTSW 4 86807466 missense probably damaging 1.00
R1370:Dennd4c UTSW 4 86811510 missense probably damaging 1.00
R1381:Dennd4c UTSW 4 86774532 missense probably benign 0.24
R1569:Dennd4c UTSW 4 86786094 missense possibly damaging 0.59
R1747:Dennd4c UTSW 4 86807438 missense probably damaging 1.00
R1764:Dennd4c UTSW 4 86803010 missense probably damaging 1.00
R1838:Dennd4c UTSW 4 86825178 missense probably benign 0.00
R1997:Dennd4c UTSW 4 86837397 missense probably benign
R2244:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R2348:Dennd4c UTSW 4 86811527 missense probably benign 0.04
R2968:Dennd4c UTSW 4 86781644 missense possibly damaging 0.93
R3033:Dennd4c UTSW 4 86825320 small deletion probably benign
R3401:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3402:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3403:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3855:Dennd4c UTSW 4 86779847 missense probably damaging 1.00
R3939:Dennd4c UTSW 4 86774280 missense probably damaging 1.00
R4164:Dennd4c UTSW 4 86807527 missense probably benign 0.01
R4384:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R4435:Dennd4c UTSW 4 86798075 missense probably benign 0.44
R4788:Dennd4c UTSW 4 86819963 missense probably benign 0.00
R4801:Dennd4c UTSW 4 86819884 nonsense probably null
R4802:Dennd4c UTSW 4 86819884 nonsense probably null
R4818:Dennd4c UTSW 4 86825274 missense probably benign 0.00
R4958:Dennd4c UTSW 4 86781679 missense probably damaging 1.00
R5025:Dennd4c UTSW 4 86795299 critical splice donor site probably null
R5434:Dennd4c UTSW 4 86811456 missense probably benign 0.10
R5662:Dennd4c UTSW 4 86795288 missense probably benign 0.13
R5802:Dennd4c UTSW 4 86811453 missense probably benign 0.02
R5849:Dennd4c UTSW 4 86825986 missense possibly damaging 0.58
R5861:Dennd4c UTSW 4 86791352 missense probably benign 0.30
R5970:Dennd4c UTSW 4 86825512 missense probably damaging 1.00
R6163:Dennd4c UTSW 4 86805591 missense possibly damaging 0.56
R6356:Dennd4c UTSW 4 86825449 missense probably benign
R6661:Dennd4c UTSW 4 86799389 missense possibly damaging 0.66
R6855:Dennd4c UTSW 4 86836457 missense probably benign
R6983:Dennd4c UTSW 4 86799493 missense probably damaging 1.00
R7035:Dennd4c UTSW 4 86812337 missense probably damaging 1.00
R7126:Dennd4c UTSW 4 86807430 missense probably damaging 1.00
R7185:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R7212:Dennd4c UTSW 4 86802991 missense probably damaging 1.00
R7324:Dennd4c UTSW 4 86829738 missense unknown
R7329:Dennd4c UTSW 4 86779874 missense possibly damaging 0.81
R7329:Dennd4c UTSW 4 86841081 missense probably damaging 1.00
R7466:Dennd4c UTSW 4 86774331 missense probably damaging 0.99
R7479:Dennd4c UTSW 4 86799353 missense probably damaging 1.00
R7538:Dennd4c UTSW 4 86774516 missense probably damaging 1.00
R7599:Dennd4c UTSW 4 86811612 missense probably damaging 1.00
R7688:Dennd4c UTSW 4 86795140 missense probably damaging 1.00
R7725:Dennd4c UTSW 4 86786093 missense probably benign 0.00
R7751:Dennd4c UTSW 4 86828942 missense probably benign 0.05
R7790:Dennd4c UTSW 4 86799517 missense probably damaging 0.96
R8056:Dennd4c UTSW 4 86844976 missense probably null 0.71
R8307:Dennd4c UTSW 4 86825872 missense probably benign 0.12
R8494:Dennd4c UTSW 4 86841075 missense probably damaging 1.00
R8531:Dennd4c UTSW 4 86826082 critical splice donor site probably null
R9014:Dennd4c UTSW 4 86821465 missense probably benign 0.07
R9014:Dennd4c UTSW 4 86836429 missense probably benign 0.00
R9017:Dennd4c UTSW 4 86825112 missense probably benign 0.33
R9142:Dennd4c UTSW 4 86837400 missense probably benign 0.32
R9224:Dennd4c UTSW 4 86819933 nonsense probably null
R9570:Dennd4c UTSW 4 86828971 missense possibly damaging 0.71
R9644:Dennd4c UTSW 4 86795126 missense probably damaging 0.99
R9649:Dennd4c UTSW 4 86824923 missense probably benign 0.00
R9658:Dennd4c UTSW 4 86836388 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGGACATTCTGTAATACGAGC -3'
(R):5'- GTTTGTTTGAATCTCAAGACTTCCC -3'

Sequencing Primer
(F):5'- CGAGCAATGTTTTCTCATACTTTG -3'
(R):5'- GACTTCCCTTAAATATAAATGGGTGC -3'
Posted On 2016-04-15