Mutagenetix > Incidental Mutations

Incidental Mutation 'R0400:Cers3'

38129

Institutional Source

Beutler Lab

Gene Symbol

Cers3

Ensembl Gene

ENSMUSG00000030510

Gene Name

ceramide synthase 3

Synonyms

related to TRH3, Lass3, T3L, CerS3, 4930550L11Rik, LOC233330

MMRRC Submission

038605-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.315) question?

Stock #

R0400 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66743504-66823691 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 66764330 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 88 (V88A)

Ref Sequence

ENSEMBL: ENSMUSP00000069238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066475] [ENSMUST00000208521]

AlphaFold

Q1A3B0

Predicted Effect

probably benign
Transcript: ENSMUST00000066475
AA Change: V88A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000069238
Gene: ENSMUSG00000030510
AA Change: V88A

Domain	Start	End	E-Value	Type
transmembrane domain	66	88	N/A	INTRINSIC
HOX	110	167	2.48e-2	SMART
TLC	166	367	6.52e-57	SMART
low complexity region	379	391	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000208521
AA Change: V52A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.8%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ceramide synthase family of genes. The ceramide synthase enzymes regulate sphingolipid synthesis by catalyzing the formation of ceramides from sphingoid base and acyl-coA substrates. This family member is involved in the synthesis of ceramides with ultra-long-chain acyl moieties (ULC-Cers), important to the epidermis in its role in creating a protective barrier from the environment. The protein encoded by this gene has also been implicated in modification of the lipid structures required for spermatogenesis. Mutations in this gene have been associated with male fertility defects, and epidermal defects, including ichthyosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a lethal skin barrier disruption defect due to a lack of ultra-long-chain acyl ceramides, impaired stratum corneum desquamation, accelerated lamellar body biogenesis and extrusion, and delayed keratinocyte cornification. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	T	A	11: 30,426,360	H169L	probably benign	Het
9130230L23Rik	T	C	5: 65,990,356	D28G	unknown	Het
Abca12	T	A	1: 71,259,776		probably benign	Het
Acsl5	T	C	19: 55,293,711	V573A	probably damaging	Het
Agap1	A	G	1: 89,843,250		probably benign	Het
Arid2	A	G	15: 96,356,925		probably benign	Het
B430305J03Rik	T	A	3: 61,364,135		probably benign	Het
Brsk2	T	C	7: 141,998,553	L584P	probably damaging	Het
C2cd4c	A	G	10: 79,613,209	Y35H	probably damaging	Het
Cacul1	A	G	19: 60,563,153		probably benign	Het
Cnnm1	A	T	19: 43,468,364	H614L	probably damaging	Het
Col1a1	T	A	11: 94,941,369		probably benign	Het
Cyp1b1	T	A	17: 79,713,587	D242V	probably damaging	Het
Cyp4a31	T	C	4: 115,563,718	M1T	probably null	Het
Dbn1	C	T	13: 55,474,916	E585K	probably damaging	Het
Dclk2	A	T	3: 86,813,747		probably null	Het
Ddx58	A	G	4: 40,235,257	Y78H	probably benign	Het
Dnah17	A	G	11: 118,082,078	S2010P	probably damaging	Het
Dram2	T	C	3: 106,573,618	L246P	probably damaging	Het
Dus2	A	T	8: 106,048,677	T279S	probably benign	Het
Epn2	T	C	11: 61,532,696		probably null	Het
Esco2	C	A	14: 65,831,706	V52F	possibly damaging	Het
Fbp1	T	A	13: 62,865,068	T104S	probably benign	Het
Foxj2	A	T	6: 122,833,808	Q249L	possibly damaging	Het
Galnt7	T	C	8: 57,583,989	Y122C	probably damaging	Het
Gimd1	T	C	3: 132,634,827	Y35H	probably benign	Het
Gipc2	A	G	3: 152,165,668	F74L	probably damaging	Het
Glt1d1	T	A	5: 127,657,075		probably benign	Het
Hmcn2	A	G	2: 31,400,129	T2325A	probably damaging	Het
Iffo1	A	G	6: 125,153,471	K471R	probably damaging	Het
Ireb2	G	A	9: 54,896,498	R491H	probably benign	Het
Isg20	A	G	7: 78,916,725	N141D	possibly damaging	Het
Kmt5c	G	A	7: 4,746,244	R100H	probably benign	Het
Lrp1b	T	C	2: 40,750,914	D3506G	probably benign	Het
Lrrn4	A	C	2: 132,878,020	F287V	probably benign	Het
Mmrn1	A	C	6: 60,977,115	K793N	probably benign	Het
Muc16	A	G	9: 18,510,534	V8227A	possibly damaging	Het
Myh2	C	T	11: 67,192,598		probably benign	Het
Nalcn	T	A	14: 123,290,960		probably benign	Het
Nfia	T	C	4: 98,063,136	V400A	probably damaging	Het
Nxph4	T	A	10: 127,526,258	T255S	possibly damaging	Het
Olfm5	G	A	7: 104,154,179	T359I	probably damaging	Het
Olfr141	A	G	2: 86,806,651	M116T	probably damaging	Het
Olfr393	T	C	11: 73,848,041	Y28C	probably benign	Het
Olfr907	A	G	9: 38,498,911	M81V	possibly damaging	Het
Olfr935	G	T	9: 38,995,198	P79Q	probably damaging	Het
Pak7	T	C	2: 136,097,579	I545M	possibly damaging	Het
Pcdhb15	T	C	18: 37,475,895	F727L	probably benign	Het
Pds5b	T	A	5: 150,723,353	N202K	possibly damaging	Het
Phlpp1	T	A	1: 106,392,934	I1553N	probably benign	Het
Pink1	T	C	4: 138,317,918	T282A	probably damaging	Het
Prdm2	A	G	4: 143,111,670	F1706S	probably benign	Het
Pycr1	G	A	11: 120,641,526		probably benign	Het
Skint9	A	G	4: 112,414,001	S71P	probably damaging	Het
Smad1	A	G	8: 79,371,770		probably benign	Het
Snapc5	A	T	9: 64,180,507	E33D	probably damaging	Het
Snrnp40	T	C	4: 130,362,650	L56P	probably damaging	Het
Stab2	A	C	10: 86,872,610	I1697S	probably damaging	Het
Tfap2a	G	T	13: 40,717,412		probably benign	Het
Tmem57	T	C	4: 134,828,116	K349E	probably benign	Het
Tph2	A	G	10: 115,080,120		probably benign	Het
Triml1	A	G	8: 43,141,040	V118A	probably benign	Het
Ttbk2	T	A	2: 120,750,242	T538S	probably benign	Het
Ttn	A	G	2: 76,715,272	V32569A	possibly damaging	Het
U2af1	T	A	17: 31,648,192	Y158F	probably benign	Het
Usp7	A	T	16: 8,716,632		probably benign	Het
Vdr	A	G	15: 97,869,351	S179P	probably benign	Het
Vps13d	A	C	4: 145,065,827	S663A	probably benign	Het
Wdr62	T	A	7: 30,241,462	T844S	possibly damaging	Het
Wipi1	C	T	11: 109,577,130	R407Q	probably damaging	Het
Zbtb43	A	G	2: 33,453,897	C439R	probably damaging	Het
Zfp507	T	A	7: 35,791,746	H704L	probably damaging	Het
Zzef1	G	A	11: 72,895,242	R2080K	probably damaging	Het

Other mutations in Cers3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01321:Cers3	APN	7	66786003	splice site	probably benign
IGL02832:Cers3	APN	7	66781825	missense	probably benign	0.00
R0490:Cers3	UTSW	7	66773690	missense	possibly damaging	0.69
R0558:Cers3	UTSW	7	66783418	missense	probably damaging	1.00
R0571:Cers3	UTSW	7	66786057	missense	possibly damaging	0.93
R1452:Cers3	UTSW	7	66783404	missense	probably damaging	1.00
R1538:Cers3	UTSW	7	66781823	missense	probably damaging	0.98
R1767:Cers3	UTSW	7	66783403	missense	probably damaging	1.00
R2155:Cers3	UTSW	7	66783414	missense	probably damaging	0.99
R2427:Cers3	UTSW	7	66795793	missense	probably benign	0.04
R3705:Cers3	UTSW	7	66786075	missense	probably benign	0.25
R3713:Cers3	UTSW	7	66786075	missense	probably benign	0.25
R3714:Cers3	UTSW	7	66786075	missense	probably benign	0.25
R3715:Cers3	UTSW	7	66786075	missense	probably benign	0.25
R3961:Cers3	UTSW	7	66786075	missense	probably benign	0.25
R3963:Cers3	UTSW	7	66786075	missense	probably benign	0.25
R4238:Cers3	UTSW	7	66773676	missense	probably damaging	1.00
R4652:Cers3	UTSW	7	66781856	splice site	probably null
R5174:Cers3	UTSW	7	66784868	missense	probably damaging	1.00
R6493:Cers3	UTSW	7	66743720	missense	probably benign	0.07
R6675:Cers3	UTSW	7	66786096	missense	possibly damaging	0.50
R6807:Cers3	UTSW	7	66764220	missense	probably damaging	1.00
R6833:Cers3	UTSW	7	66779671	critical splice donor site	probably null
R7223:Cers3	UTSW	7	66783415	missense	probably damaging	0.99
R7592:Cers3	UTSW	7	66789629	missense	probably damaging	1.00
R7835:Cers3	UTSW	7	66773639	missense	possibly damaging	0.79
R8202:Cers3	UTSW	7	66786013	missense	probably damaging	0.99
R8322:Cers3	UTSW	7	66789638	missense	probably damaging	1.00
R8350:Cers3	UTSW	7	66764342	missense	possibly damaging	0.54
R8450:Cers3	UTSW	7	66764342	missense	possibly damaging	0.54
R8757:Cers3	UTSW	7	66786102	missense	probably damaging	1.00
R8759:Cers3	UTSW	7	66786102	missense	probably damaging	1.00
R9149:Cers3	UTSW	7	66743694	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- TCCCAGTTCCAAGTGCTGAGGATAC -3'
(R):5'- TCACTGTGATATTCCCACACATGCC -3'

Sequencing Primer
(F):5'- GGATACGAAGCTAACATATCCTTTTC -3'
(R):5'- gagagatggctcagcgg -3'

Posted On

2013-05-23