Incidental Mutation 'R0400:Cers3'
ID 38129
Institutional Source Beutler Lab
Gene Symbol Cers3
Ensembl Gene ENSMUSG00000030510
Gene Name ceramide synthase 3
Synonyms related to TRH3, Lass3, T3L, CerS3, 4930550L11Rik, LOC233330
MMRRC Submission 038605-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock # R0400 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 66743504-66823691 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66764330 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 88 (V88A)
Ref Sequence ENSEMBL: ENSMUSP00000069238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066475] [ENSMUST00000208521]
AlphaFold Q1A3B0
Predicted Effect probably benign
Transcript: ENSMUST00000066475
AA Change: V88A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000069238
Gene: ENSMUSG00000030510
AA Change: V88A

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
HOX 110 167 2.48e-2 SMART
TLC 166 367 6.52e-57 SMART
low complexity region 379 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208521
AA Change: V52A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ceramide synthase family of genes. The ceramide synthase enzymes regulate sphingolipid synthesis by catalyzing the formation of ceramides from sphingoid base and acyl-coA substrates. This family member is involved in the synthesis of ceramides with ultra-long-chain acyl moieties (ULC-Cers), important to the epidermis in its role in creating a protective barrier from the environment. The protein encoded by this gene has also been implicated in modification of the lipid structures required for spermatogenesis. Mutations in this gene have been associated with male fertility defects, and epidermal defects, including ichthyosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a lethal skin barrier disruption defect due to a lack of ultra-long-chain acyl ceramides, impaired stratum corneum desquamation, accelerated lamellar body biogenesis and extrusion, and delayed keratinocyte cornification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik T A 11: 30,426,360 H169L probably benign Het
9130230L23Rik T C 5: 65,990,356 D28G unknown Het
Abca12 T A 1: 71,259,776 probably benign Het
Acsl5 T C 19: 55,293,711 V573A probably damaging Het
Agap1 A G 1: 89,843,250 probably benign Het
Arid2 A G 15: 96,356,925 probably benign Het
B430305J03Rik T A 3: 61,364,135 probably benign Het
Brsk2 T C 7: 141,998,553 L584P probably damaging Het
C2cd4c A G 10: 79,613,209 Y35H probably damaging Het
Cacul1 A G 19: 60,563,153 probably benign Het
Cnnm1 A T 19: 43,468,364 H614L probably damaging Het
Col1a1 T A 11: 94,941,369 probably benign Het
Cyp1b1 T A 17: 79,713,587 D242V probably damaging Het
Cyp4a31 T C 4: 115,563,718 M1T probably null Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dclk2 A T 3: 86,813,747 probably null Het
Ddx58 A G 4: 40,235,257 Y78H probably benign Het
Dnah17 A G 11: 118,082,078 S2010P probably damaging Het
Dram2 T C 3: 106,573,618 L246P probably damaging Het
Dus2 A T 8: 106,048,677 T279S probably benign Het
Epn2 T C 11: 61,532,696 probably null Het
Esco2 C A 14: 65,831,706 V52F possibly damaging Het
Fbp1 T A 13: 62,865,068 T104S probably benign Het
Foxj2 A T 6: 122,833,808 Q249L possibly damaging Het
Galnt7 T C 8: 57,583,989 Y122C probably damaging Het
Gimd1 T C 3: 132,634,827 Y35H probably benign Het
Gipc2 A G 3: 152,165,668 F74L probably damaging Het
Glt1d1 T A 5: 127,657,075 probably benign Het
Hmcn2 A G 2: 31,400,129 T2325A probably damaging Het
Iffo1 A G 6: 125,153,471 K471R probably damaging Het
Ireb2 G A 9: 54,896,498 R491H probably benign Het
Isg20 A G 7: 78,916,725 N141D possibly damaging Het
Kmt5c G A 7: 4,746,244 R100H probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrn4 A C 2: 132,878,020 F287V probably benign Het
Mmrn1 A C 6: 60,977,115 K793N probably benign Het
Muc16 A G 9: 18,510,534 V8227A possibly damaging Het
Myh2 C T 11: 67,192,598 probably benign Het
Nalcn T A 14: 123,290,960 probably benign Het
Nfia T C 4: 98,063,136 V400A probably damaging Het
Nxph4 T A 10: 127,526,258 T255S possibly damaging Het
Olfm5 G A 7: 104,154,179 T359I probably damaging Het
Olfr141 A G 2: 86,806,651 M116T probably damaging Het
Olfr393 T C 11: 73,848,041 Y28C probably benign Het
Olfr907 A G 9: 38,498,911 M81V possibly damaging Het
Olfr935 G T 9: 38,995,198 P79Q probably damaging Het
Pak7 T C 2: 136,097,579 I545M possibly damaging Het
Pcdhb15 T C 18: 37,475,895 F727L probably benign Het
Pds5b T A 5: 150,723,353 N202K possibly damaging Het
Phlpp1 T A 1: 106,392,934 I1553N probably benign Het
Pink1 T C 4: 138,317,918 T282A probably damaging Het
Prdm2 A G 4: 143,111,670 F1706S probably benign Het
Pycr1 G A 11: 120,641,526 probably benign Het
Skint9 A G 4: 112,414,001 S71P probably damaging Het
Smad1 A G 8: 79,371,770 probably benign Het
Snapc5 A T 9: 64,180,507 E33D probably damaging Het
Snrnp40 T C 4: 130,362,650 L56P probably damaging Het
Stab2 A C 10: 86,872,610 I1697S probably damaging Het
Tfap2a G T 13: 40,717,412 probably benign Het
Tmem57 T C 4: 134,828,116 K349E probably benign Het
Tph2 A G 10: 115,080,120 probably benign Het
Triml1 A G 8: 43,141,040 V118A probably benign Het
Ttbk2 T A 2: 120,750,242 T538S probably benign Het
Ttn A G 2: 76,715,272 V32569A possibly damaging Het
U2af1 T A 17: 31,648,192 Y158F probably benign Het
Usp7 A T 16: 8,716,632 probably benign Het
Vdr A G 15: 97,869,351 S179P probably benign Het
Vps13d A C 4: 145,065,827 S663A probably benign Het
Wdr62 T A 7: 30,241,462 T844S possibly damaging Het
Wipi1 C T 11: 109,577,130 R407Q probably damaging Het
Zbtb43 A G 2: 33,453,897 C439R probably damaging Het
Zfp507 T A 7: 35,791,746 H704L probably damaging Het
Zzef1 G A 11: 72,895,242 R2080K probably damaging Het
Other mutations in Cers3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Cers3 APN 7 66786003 splice site probably benign
IGL02832:Cers3 APN 7 66781825 missense probably benign 0.00
R0490:Cers3 UTSW 7 66773690 missense possibly damaging 0.69
R0558:Cers3 UTSW 7 66783418 missense probably damaging 1.00
R0571:Cers3 UTSW 7 66786057 missense possibly damaging 0.93
R1452:Cers3 UTSW 7 66783404 missense probably damaging 1.00
R1538:Cers3 UTSW 7 66781823 missense probably damaging 0.98
R1767:Cers3 UTSW 7 66783403 missense probably damaging 1.00
R2155:Cers3 UTSW 7 66783414 missense probably damaging 0.99
R2427:Cers3 UTSW 7 66795793 missense probably benign 0.04
R3705:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3713:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3714:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3715:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3961:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3963:Cers3 UTSW 7 66786075 missense probably benign 0.25
R4238:Cers3 UTSW 7 66773676 missense probably damaging 1.00
R4652:Cers3 UTSW 7 66781856 splice site probably null
R5174:Cers3 UTSW 7 66784868 missense probably damaging 1.00
R6493:Cers3 UTSW 7 66743720 missense probably benign 0.07
R6675:Cers3 UTSW 7 66786096 missense possibly damaging 0.50
R6807:Cers3 UTSW 7 66764220 missense probably damaging 1.00
R6833:Cers3 UTSW 7 66779671 critical splice donor site probably null
R7223:Cers3 UTSW 7 66783415 missense probably damaging 0.99
R7592:Cers3 UTSW 7 66789629 missense probably damaging 1.00
R7835:Cers3 UTSW 7 66773639 missense possibly damaging 0.79
R8202:Cers3 UTSW 7 66786013 missense probably damaging 0.99
R8322:Cers3 UTSW 7 66789638 missense probably damaging 1.00
R8350:Cers3 UTSW 7 66764342 missense possibly damaging 0.54
R8450:Cers3 UTSW 7 66764342 missense possibly damaging 0.54
R8757:Cers3 UTSW 7 66786102 missense probably damaging 1.00
R8759:Cers3 UTSW 7 66786102 missense probably damaging 1.00
R9149:Cers3 UTSW 7 66743694 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TCCCAGTTCCAAGTGCTGAGGATAC -3'
(R):5'- TCACTGTGATATTCCCACACATGCC -3'

Sequencing Primer
(F):5'- GGATACGAAGCTAACATATCCTTTTC -3'
(R):5'- gagagatggctcagcgg -3'
Posted On 2013-05-23