Incidental Mutation 'R0400:Myh2'
ID38148
Institutional Source Beutler Lab
Gene Symbol Myh2
Ensembl Gene ENSMUSG00000033196
Gene Namemyosin, heavy polypeptide 2, skeletal muscle, adult
SynonymsMHC2A, Myhs-f, Myhsf1, Myhs-f1, MyHC-IIa
MMRRC Submission 038605-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R0400 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67171027-67197517 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 67192598 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018641] [ENSMUST00000170159]
Predicted Effect probably benign
Transcript: ENSMUST00000018641
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145346
Predicted Effect probably benign
Transcript: ENSMUST00000170159
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik T A 11: 30,426,360 H169L probably benign Het
9130230L23Rik T C 5: 65,990,356 D28G unknown Het
Abca12 T A 1: 71,259,776 probably benign Het
Acsl5 T C 19: 55,293,711 V573A probably damaging Het
Agap1 A G 1: 89,843,250 probably benign Het
Arid2 A G 15: 96,356,925 probably benign Het
B430305J03Rik T A 3: 61,364,135 probably benign Het
Brsk2 T C 7: 141,998,553 L584P probably damaging Het
C2cd4c A G 10: 79,613,209 Y35H probably damaging Het
Cacul1 A G 19: 60,563,153 probably benign Het
Cers3 T C 7: 66,764,330 V88A probably benign Het
Cnnm1 A T 19: 43,468,364 H614L probably damaging Het
Col1a1 T A 11: 94,941,369 probably benign Het
Cyp1b1 T A 17: 79,713,587 D242V probably damaging Het
Cyp4a31 T C 4: 115,563,718 M1T probably null Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dclk2 A T 3: 86,813,747 probably null Het
Ddx58 A G 4: 40,235,257 Y78H probably benign Het
Dnah17 A G 11: 118,082,078 S2010P probably damaging Het
Dram2 T C 3: 106,573,618 L246P probably damaging Het
Dus2 A T 8: 106,048,677 T279S probably benign Het
Epn2 T C 11: 61,532,696 probably null Het
Esco2 C A 14: 65,831,706 V52F possibly damaging Het
Fbp1 T A 13: 62,865,068 T104S probably benign Het
Foxj2 A T 6: 122,833,808 Q249L possibly damaging Het
Galnt7 T C 8: 57,583,989 Y122C probably damaging Het
Gimd1 T C 3: 132,634,827 Y35H probably benign Het
Gipc2 A G 3: 152,165,668 F74L probably damaging Het
Glt1d1 T A 5: 127,657,075 probably benign Het
Hmcn2 A G 2: 31,400,129 T2325A probably damaging Het
Iffo1 A G 6: 125,153,471 K471R probably damaging Het
Ireb2 G A 9: 54,896,498 R491H probably benign Het
Isg20 A G 7: 78,916,725 N141D possibly damaging Het
Kmt5c G A 7: 4,746,244 R100H probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrn4 A C 2: 132,878,020 F287V probably benign Het
Mmrn1 A C 6: 60,977,115 K793N probably benign Het
Muc16 A G 9: 18,510,534 V8227A possibly damaging Het
Nalcn T A 14: 123,290,960 probably benign Het
Nfia T C 4: 98,063,136 V400A probably damaging Het
Nxph4 T A 10: 127,526,258 T255S possibly damaging Het
Olfm5 G A 7: 104,154,179 T359I probably damaging Het
Olfr141 A G 2: 86,806,651 M116T probably damaging Het
Olfr393 T C 11: 73,848,041 Y28C probably benign Het
Olfr907 A G 9: 38,498,911 M81V possibly damaging Het
Olfr935 G T 9: 38,995,198 P79Q probably damaging Het
Pak7 T C 2: 136,097,579 I545M possibly damaging Het
Pcdhb15 T C 18: 37,475,895 F727L probably benign Het
Pds5b T A 5: 150,723,353 N202K possibly damaging Het
Phlpp1 T A 1: 106,392,934 I1553N probably benign Het
Pink1 T C 4: 138,317,918 T282A probably damaging Het
Prdm2 A G 4: 143,111,670 F1706S probably benign Het
Pycr1 G A 11: 120,641,526 probably benign Het
Skint9 A G 4: 112,414,001 S71P probably damaging Het
Smad1 A G 8: 79,371,770 probably benign Het
Snapc5 A T 9: 64,180,507 E33D probably damaging Het
Snrnp40 T C 4: 130,362,650 L56P probably damaging Het
Stab2 A C 10: 86,872,610 I1697S probably damaging Het
Tfap2a G T 13: 40,717,412 probably benign Het
Tmem57 T C 4: 134,828,116 K349E probably benign Het
Tph2 A G 10: 115,080,120 probably benign Het
Triml1 A G 8: 43,141,040 V118A probably benign Het
Ttbk2 T A 2: 120,750,242 T538S probably benign Het
Ttn A G 2: 76,715,272 V32569A possibly damaging Het
U2af1 T A 17: 31,648,192 Y158F probably benign Het
Usp7 A T 16: 8,716,632 probably benign Het
Vdr A G 15: 97,869,351 S179P probably benign Het
Vps13d A C 4: 145,065,827 S663A probably benign Het
Wdr62 T A 7: 30,241,462 T844S possibly damaging Het
Wipi1 C T 11: 109,577,130 R407Q probably damaging Het
Zbtb43 A G 2: 33,453,897 C439R probably damaging Het
Zfp507 T A 7: 35,791,746 H704L probably damaging Het
Zzef1 G A 11: 72,895,242 R2080K probably damaging Het
Other mutations in Myh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Myh2 APN 11 67185233 missense possibly damaging 0.88
IGL00330:Myh2 APN 11 67193440 missense probably benign 0.06
IGL00423:Myh2 APN 11 67197345 missense probably benign
IGL00429:Myh2 APN 11 67180790 nonsense probably null
IGL00465:Myh2 APN 11 67178833 splice site probably benign
IGL00671:Myh2 APN 11 67193357 missense probably damaging 0.97
IGL00773:Myh2 APN 11 67194421 missense probably benign
IGL00821:Myh2 APN 11 67197397 utr 3 prime probably benign
IGL00900:Myh2 APN 11 67179384 missense probably damaging 1.00
IGL01374:Myh2 APN 11 67177424 missense probably benign 0.05
IGL01613:Myh2 APN 11 67197344 missense probably benign 0.01
IGL01845:Myh2 APN 11 67193034 missense probably benign 0.02
IGL01900:Myh2 APN 11 67183783 missense probably benign 0.01
IGL01936:Myh2 APN 11 67191773 missense possibly damaging 0.94
IGL02129:Myh2 APN 11 67185258 missense probably benign 0.05
IGL02172:Myh2 APN 11 67189052 missense possibly damaging 0.78
IGL02554:Myh2 APN 11 67189165 missense probably benign 0.00
IGL02578:Myh2 APN 11 67186691 missense probably benign 0.33
IGL03075:Myh2 APN 11 67180836 missense probably benign 0.39
IGL03078:Myh2 APN 11 67190430 missense probably benign
IGL03117:Myh2 APN 11 67180884 missense possibly damaging 0.91
IGL03255:Myh2 APN 11 67193225 missense probably damaging 1.00
IGL03266:Myh2 APN 11 67176324 missense probably benign
IGL03366:Myh2 APN 11 67183523 missense probably damaging 1.00
IGL03412:Myh2 APN 11 67189569 missense probably benign 0.04
limp UTSW 11 67192504 missense probably damaging 1.00
noodle UTSW 11 67186612 missense probably benign
PIT4403001:Myh2 UTSW 11 67186707 missense probably benign 0.22
PIT4508001:Myh2 UTSW 11 67185505 missense probably benign 0.00
PIT4677001:Myh2 UTSW 11 67181992 missense probably benign
R0039:Myh2 UTSW 11 67178277 missense probably damaging 1.00
R0347:Myh2 UTSW 11 67185304 splice site probably benign
R0389:Myh2 UTSW 11 67180821 missense probably damaging 1.00
R0512:Myh2 UTSW 11 67188678 missense probably damaging 1.00
R0555:Myh2 UTSW 11 67178967 missense probably damaging 1.00
R0746:Myh2 UTSW 11 67173431 missense probably benign 0.00
R0842:Myh2 UTSW 11 67179524 missense possibly damaging 0.83
R0893:Myh2 UTSW 11 67186508 missense possibly damaging 0.82
R1218:Myh2 UTSW 11 67192525 missense probably damaging 0.99
R1264:Myh2 UTSW 11 67180778 missense probably damaging 0.96
R1398:Myh2 UTSW 11 67185287 missense probably benign 0.14
R1774:Myh2 UTSW 11 67173474 missense possibly damaging 0.96
R1800:Myh2 UTSW 11 67188938 missense probably damaging 0.99
R1829:Myh2 UTSW 11 67176559 missense probably damaging 0.98
R1840:Myh2 UTSW 11 67186487 missense probably benign 0.16
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1969:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1971:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1985:Myh2 UTSW 11 67180914 missense possibly damaging 0.65
R2021:Myh2 UTSW 11 67191719 missense probably damaging 1.00
R2029:Myh2 UTSW 11 67194625 missense possibly damaging 0.85
R2057:Myh2 UTSW 11 67188839 critical splice donor site probably null
R2080:Myh2 UTSW 11 67174941 critical splice acceptor site probably null
R2142:Myh2 UTSW 11 67189332 missense probably damaging 1.00
R2215:Myh2 UTSW 11 67191737 missense probably benign 0.35
R2225:Myh2 UTSW 11 67193729 missense probably benign
R2274:Myh2 UTSW 11 67190358 missense possibly damaging 0.84
R3018:Myh2 UTSW 11 67179584 missense possibly damaging 0.67
R3113:Myh2 UTSW 11 67185186 missense probably damaging 1.00
R3703:Myh2 UTSW 11 67189601 missense probably benign 0.01
R4022:Myh2 UTSW 11 67179404 nonsense probably null
R4081:Myh2 UTSW 11 67190430 missense probably benign 0.11
R4191:Myh2 UTSW 11 67177400 missense possibly damaging 0.81
R4291:Myh2 UTSW 11 67181159 missense probably benign 0.01
R4292:Myh2 UTSW 11 67194897 missense possibly damaging 0.46
R4424:Myh2 UTSW 11 67192725 missense probably benign 0.01
R4524:Myh2 UTSW 11 67176270 missense probably damaging 1.00
R4578:Myh2 UTSW 11 67173258 missense possibly damaging 0.85
R4597:Myh2 UTSW 11 67189418 missense probably benign 0.01
R4641:Myh2 UTSW 11 67194694 missense probably damaging 1.00
R4672:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4673:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4804:Myh2 UTSW 11 67186502 missense possibly damaging 0.78
R4818:Myh2 UTSW 11 67176255 missense probably damaging 1.00
R4943:Myh2 UTSW 11 67197317 missense probably damaging 1.00
R4958:Myh2 UTSW 11 67192959 missense possibly damaging 0.83
R5139:Myh2 UTSW 11 67179348 missense probably damaging 1.00
R5239:Myh2 UTSW 11 67192443 missense probably benign 0.00
R5306:Myh2 UTSW 11 67186556 missense probably damaging 1.00
R5492:Myh2 UTSW 11 67180875 missense probably benign 0.20
R5503:Myh2 UTSW 11 67173449 missense probably benign
R5646:Myh2 UTSW 11 67188812 missense probably benign 0.07
R5750:Myh2 UTSW 11 67191428 missense probably benign
R5806:Myh2 UTSW 11 67181315 missense probably damaging 0.98
R5878:Myh2 UTSW 11 67192504 missense probably damaging 1.00
R5892:Myh2 UTSW 11 67185176 nonsense probably null
R5898:Myh2 UTSW 11 67192719 missense possibly damaging 0.51
R6154:Myh2 UTSW 11 67186612 missense probably benign
R6156:Myh2 UTSW 11 67181053 missense probably damaging 0.98
R6236:Myh2 UTSW 11 67190331 missense probably benign 0.00
R6349:Myh2 UTSW 11 67193003 missense probably benign 0.04
R6441:Myh2 UTSW 11 67194611 missense probably benign 0.00
R6548:Myh2 UTSW 11 67186612 missense probably benign
R6681:Myh2 UTSW 11 67178348 missense probably damaging 1.00
R6907:Myh2 UTSW 11 67193741 missense probably damaging 1.00
R6925:Myh2 UTSW 11 67193218 missense probably benign 0.00
R6969:Myh2 UTSW 11 67197266 missense probably benign
R7172:Myh2 UTSW 11 67188701 missense probably benign 0.00
R7257:Myh2 UTSW 11 67181150 missense possibly damaging 0.70
R7286:Myh2 UTSW 11 67188369 missense probably benign 0.23
R7323:Myh2 UTSW 11 67197365 missense probably benign
R7396:Myh2 UTSW 11 67194728 critical splice donor site probably null
R7468:Myh2 UTSW 11 67192542 missense probably benign 0.01
R7585:Myh2 UTSW 11 67179411 critical splice donor site probably null
R7709:Myh2 UTSW 11 67194864 missense probably benign 0.00
X0026:Myh2 UTSW 11 67175022 missense probably benign 0.10
X0065:Myh2 UTSW 11 67176259 missense probably damaging 0.99
Z1088:Myh2 UTSW 11 67180763 critical splice acceptor site probably benign
Z1088:Myh2 UTSW 11 67191449 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGAAGCCGTGAACGCCAAGTG -3'
(R):5'- CTGTTCCGTGAGGTCAGAAATCTCC -3'

Sequencing Primer
(F):5'- TCTCTGGAGAAGACGAAGCA -3'
(R):5'- CATAGAAGAGCGAGTGTTCCCTC -3'
Posted On2013-05-23