Incidental Mutation 'R4955:3110009E18Rik'
ID381513
Institutional Source Beutler Lab
Gene Symbol 3110009E18Rik
Ensembl Gene ENSMUSG00000026388
Gene NameRIKEN cDNA 3110009E18 gene
Synonyms
MMRRC Submission 042552-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4955 (G1)
Quality Score169
Status Validated
Chromosome1
Chromosomal Location120121187-120188189 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 120169119 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027637] [ENSMUST00000056038] [ENSMUST00000112644]
Predicted Effect probably benign
Transcript: ENSMUST00000027637
SMART Domains Protein: ENSMUSP00000027637
Gene: ENSMUSG00000026388

DomainStartEndE-ValueType
Pfam:DUF2340 8 93 3.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056038
SMART Domains Protein: ENSMUSP00000053335
Gene: ENSMUSG00000026388

DomainStartEndE-ValueType
Pfam:DUF2340 8 93 3.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112644
SMART Domains Protein: ENSMUSP00000108263
Gene: ENSMUSG00000026388

DomainStartEndE-ValueType
Pfam:DUF2340 8 126 1.4e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128578
Predicted Effect unknown
Transcript: ENSMUST00000153037
AA Change: A82S
SMART Domains Protein: ENSMUSP00000115887
Gene: ENSMUSG00000026388
AA Change: A82S

DomainStartEndE-ValueType
Pfam:DUF2340 1 61 1.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187809
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,931,287 probably benign Het
Abca8a T G 11: 110,036,512 E1338D probably benign Het
Arl2bp G A 8: 94,670,428 probably null Het
Arsj T C 3: 126,438,540 Y312H probably benign Het
Atp8b2 G T 3: 89,952,920 probably benign Het
Cdh20 T C 1: 104,984,803 V594A probably damaging Het
Cfap44 T A 16: 44,475,277 V1646E possibly damaging Het
Csmd3 A T 15: 48,673,518 I96K probably damaging Het
Dusp27 T C 1: 166,108,092 Y179C probably damaging Het
Fbn2 T C 18: 58,058,383 Q1556R possibly damaging Het
Fstl5 T A 3: 76,223,876 probably null Het
Hist1h4i T A 13: 22,041,185 I47F probably damaging Het
Hivep2 T A 10: 14,130,958 M1100K probably benign Het
Ing4 C T 6: 125,048,201 A225V probably damaging Het
Kcnc3 CTT CT 7: 44,591,296 probably null Het
Khdrbs2 T A 1: 32,520,077 probably benign Het
Kif21a A T 15: 90,937,190 W1566R probably damaging Het
Lrfn5 A C 12: 61,839,978 D184A probably benign Het
Mettl2 C T 11: 105,137,779 T319I possibly damaging Het
Mgrn1 T C 16: 4,934,219 V529A probably benign Het
Naca T A 10: 128,042,215 probably benign Het
Ninj2 A G 6: 120,197,946 N26S probably damaging Het
Nqo1 A G 8: 107,388,857 S263P probably benign Het
Obscn T C 11: 59,069,172 T3566A probably benign Het
Olfr1287 A T 2: 111,449,605 H155L probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr243 A T 7: 103,716,705 Y37F probably benign Het
Olfr761 T C 17: 37,952,898 N42S probably damaging Het
Opn5 A T 17: 42,611,238 F24L probably damaging Het
Palmd A G 3: 116,924,224 V208A probably damaging Het
Plekhd1 T A 12: 80,722,021 I426N possibly damaging Het
Polq T G 16: 37,061,082 Y1203D probably benign Het
Prex1 A G 2: 166,573,223 F251S probably damaging Het
Prkd3 T C 17: 78,952,727 M816V probably null Het
Rab3gap2 C T 1: 185,267,155 probably benign Het
Rcan2 C A 17: 44,037,081 P13Q probably damaging Het
Slc35b3 A G 13: 38,932,890 V329A probably benign Het
Slc5a1 T C 5: 33,160,902 M633T probably benign Het
Stac2 A C 11: 98,043,548 L110R possibly damaging Het
Tecpr1 T C 5: 144,217,257 E126G probably damaging Het
Ttll6 A G 11: 96,138,789 D176G possibly damaging Het
Utrn C T 10: 12,861,567 probably null Het
Zfp341 T C 2: 154,638,030 V467A probably damaging Het
Other mutations in 3110009E18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:3110009E18Rik APN 1 120150606 unclassified probably benign
IGL00696:3110009E18Rik APN 1 120171426 missense probably damaging 0.98
IGL01482:3110009E18Rik APN 1 120171471 missense probably benign 0.16
IGL01996:3110009E18Rik APN 1 120150700 missense possibly damaging 0.94
R0033:3110009E18Rik UTSW 1 120188064 missense probably damaging 1.00
R0270:3110009E18Rik UTSW 1 120166176 splice site probably benign
R1025:3110009E18Rik UTSW 1 120171462 missense probably damaging 0.97
R1535:3110009E18Rik UTSW 1 120171473 missense possibly damaging 0.52
R4676:3110009E18Rik UTSW 1 120150652 missense probably damaging 1.00
R4955:3110009E18Rik UTSW 1 120169110 intron probably benign
R4955:3110009E18Rik UTSW 1 120169120 intron probably benign
R4956:3110009E18Rik UTSW 1 120169110 intron probably benign
R4956:3110009E18Rik UTSW 1 120169119 intron probably benign
R4956:3110009E18Rik UTSW 1 120169120 intron probably benign
R4957:3110009E18Rik UTSW 1 120169110 intron probably benign
R4957:3110009E18Rik UTSW 1 120169119 intron probably benign
R4957:3110009E18Rik UTSW 1 120169120 intron probably benign
R5866:3110009E18Rik UTSW 1 120169084 intron probably benign
R6151:3110009E18Rik UTSW 1 120171486 splice site probably null
R6229:3110009E18Rik UTSW 1 120171483 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTCCAAATGGTAGGGAAGGC -3'
(R):5'- TGCTGTGCAAACAGAAACTGTC -3'

Sequencing Primer
(F):5'- AAGGCAAGGGATGGTTCTG -3'
(R):5'- CCATTCTGTTTGAGCACGAGGAC -3'
Posted On2016-04-27