Incidental Mutation 'R4955:4933407L21Rik'
ID439482
Institutional Source Beutler Lab
Gene Symbol 4933407L21Rik
Ensembl Gene ENSMUSG00000026224
Gene NameRIKEN cDNA 4933407L21 gene
Synonyms
MMRRC Submission 042552-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4955 (G1)
Quality Score117
Status Validated
Chromosome1
Chromosomal Location85928483-85940624 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 85931287 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116804 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000027426
AA Change: I53N
Predicted Effect probably benign
Transcript: ENSMUST00000129392
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190367
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
Abca8a T G 11: 110,036,512 E1338D probably benign Het
Arl2bp G A 8: 94,670,428 probably null Het
Arsj T C 3: 126,438,540 Y312H probably benign Het
Atp8b2 G T 3: 89,952,920 probably benign Het
Cdh20 T C 1: 104,984,803 V594A probably damaging Het
Cfap44 T A 16: 44,475,277 V1646E possibly damaging Het
Csmd3 A T 15: 48,673,518 I96K probably damaging Het
Dusp27 T C 1: 166,108,092 Y179C probably damaging Het
Fbn2 T C 18: 58,058,383 Q1556R possibly damaging Het
Fstl5 T A 3: 76,223,876 probably null Het
Hist1h4i T A 13: 22,041,185 I47F probably damaging Het
Hivep2 T A 10: 14,130,958 M1100K probably benign Het
Ing4 C T 6: 125,048,201 A225V probably damaging Het
Kcnc3 CTT CT 7: 44,591,296 probably null Het
Khdrbs2 T A 1: 32,520,077 probably benign Het
Kif21a A T 15: 90,937,190 W1566R probably damaging Het
Lrfn5 A C 12: 61,839,978 D184A probably benign Het
Mettl2 C T 11: 105,137,779 T319I possibly damaging Het
Mgrn1 T C 16: 4,934,219 V529A probably benign Het
Naca T A 10: 128,042,215 probably benign Het
Ninj2 A G 6: 120,197,946 N26S probably damaging Het
Nqo1 A G 8: 107,388,857 S263P probably benign Het
Obscn T C 11: 59,069,172 T3566A probably benign Het
Olfr1287 A T 2: 111,449,605 H155L probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr243 A T 7: 103,716,705 Y37F probably benign Het
Olfr761 T C 17: 37,952,898 N42S probably damaging Het
Opn5 A T 17: 42,611,238 F24L probably damaging Het
Palmd A G 3: 116,924,224 V208A probably damaging Het
Plekhd1 T A 12: 80,722,021 I426N possibly damaging Het
Polq T G 16: 37,061,082 Y1203D probably benign Het
Prex1 A G 2: 166,573,223 F251S probably damaging Het
Prkd3 T C 17: 78,952,727 M816V probably null Het
Rab3gap2 C T 1: 185,267,155 probably benign Het
Rcan2 C A 17: 44,037,081 P13Q probably damaging Het
Slc35b3 A G 13: 38,932,890 V329A probably benign Het
Slc5a1 T C 5: 33,160,902 M633T probably benign Het
Stac2 A C 11: 98,043,548 L110R possibly damaging Het
Tecpr1 T C 5: 144,217,257 E126G probably damaging Het
Ttll6 A G 11: 96,138,789 D176G possibly damaging Het
Utrn C T 10: 12,861,567 probably null Het
Zfp341 T C 2: 154,638,030 V467A probably damaging Het
Other mutations in 4933407L21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0308:4933407L21Rik UTSW 1 85931286 intron probably benign
R0458:4933407L21Rik UTSW 1 85929026 missense unknown
R3155:4933407L21Rik UTSW 1 85931383 intron probably benign
R3156:4933407L21Rik UTSW 1 85931383 intron probably benign
R3886:4933407L21Rik UTSW 1 85940551 splice site probably null
R3887:4933407L21Rik UTSW 1 85940551 splice site probably null
R3888:4933407L21Rik UTSW 1 85940551 splice site probably null
R3889:4933407L21Rik UTSW 1 85940551 splice site probably null
R4743:4933407L21Rik UTSW 1 85931251 intron probably benign
R5745:4933407L21Rik UTSW 1 85931274 splice site probably null
R7429:4933407L21Rik UTSW 1 85931307 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCCCTCTCCAATGCTGTTG -3'
(R):5'- AGGCACATTGAGTACCCCAG -3'

Sequencing Primer
(F):5'- ATGTGGGTCTATCTCTCCC -3'
(R):5'- GGAGTCATAATGCATGCCTCTCAAG -3'
Posted On2016-11-02