Incidental Mutation 'R4955:Kcnc3'
ID381529
Institutional Source Beutler Lab
Gene Symbol Kcnc3
Ensembl Gene ENSMUSG00000062785
Gene Namepotassium voltage gated channel, Shaw-related subfamily, member 3
SynonymsKcr2-3, KShIIID, Kv3.3
MMRRC Submission 042552-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4955 (G1)
Quality Score161
Status Validated
Chromosome7
Chromosomal Location44590664-44604754 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CTT to CT at 44591296 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002274] [ENSMUST00000107906] [ENSMUST00000107907] [ENSMUST00000207493] [ENSMUST00000208651] [ENSMUST00000209177]
Predicted Effect probably benign
Transcript: ENSMUST00000002274
SMART Domains Protein: ENSMUSP00000002274
Gene: ENSMUSG00000002204

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Asp 72 396 6.6e-109 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107906
SMART Domains Protein: ENSMUSP00000103539
Gene: ENSMUSG00000062785

DomainStartEndE-ValueType
Pfam:Potassium_chann 1 21 8e-9 PFAM
BTB 90 194 4.38e-12 SMART
low complexity region 211 243 N/A INTRINSIC
low complexity region 251 267 N/A INTRINSIC
Pfam:Ion_trans 290 551 4.1e-45 PFAM
Pfam:Ion_trans_2 451 544 8.2e-12 PFAM
low complexity region 578 605 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
low complexity region 750 767 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107907
SMART Domains Protein: ENSMUSP00000103540
Gene: ENSMUSG00000062785

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
BTB 90 194 4.38e-12 SMART
low complexity region 211 243 N/A INTRINSIC
low complexity region 251 267 N/A INTRINSIC
Pfam:Ion_trans 351 539 1.5e-31 PFAM
Pfam:Ion_trans_2 450 544 2.4e-11 PFAM
low complexity region 578 605 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
low complexity region 729 745 N/A INTRINSIC
low complexity region 749 766 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207302
Predicted Effect probably null
Transcript: ENSMUST00000207493
Predicted Effect probably benign
Transcript: ENSMUST00000207497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208412
Predicted Effect probably null
Transcript: ENSMUST00000208651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209101
Predicted Effect probably null
Transcript: ENSMUST00000209177
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to one of these subfamilies, namely the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. Alternate splicing results in several transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozgous null mice show no overt phenotype, though mutation of this locus in conjunction with mutations in another potassium channel results in alcohol hypersensitivty, increased locomotion, and spontaneous myoclonus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4933407L21Rik T A 1: 85,931,287 probably benign Het
Abca8a T G 11: 110,036,512 E1338D probably benign Het
Arl2bp G A 8: 94,670,428 probably null Het
Arsj T C 3: 126,438,540 Y312H probably benign Het
Atp8b2 G T 3: 89,952,920 probably benign Het
Cdh20 T C 1: 104,984,803 V594A probably damaging Het
Cfap44 T A 16: 44,475,277 V1646E possibly damaging Het
Csmd3 A T 15: 48,673,518 I96K probably damaging Het
Dusp27 T C 1: 166,108,092 Y179C probably damaging Het
Fbn2 T C 18: 58,058,383 Q1556R possibly damaging Het
Fstl5 T A 3: 76,223,876 probably null Het
Hist1h4i T A 13: 22,041,185 I47F probably damaging Het
Hivep2 T A 10: 14,130,958 M1100K probably benign Het
Ing4 C T 6: 125,048,201 A225V probably damaging Het
Khdrbs2 T A 1: 32,520,077 probably benign Het
Kif21a A T 15: 90,937,190 W1566R probably damaging Het
Lrfn5 A C 12: 61,839,978 D184A probably benign Het
Mettl2 C T 11: 105,137,779 T319I possibly damaging Het
Mgrn1 T C 16: 4,934,219 V529A probably benign Het
Naca T A 10: 128,042,215 probably benign Het
Ninj2 A G 6: 120,197,946 N26S probably damaging Het
Nqo1 A G 8: 107,388,857 S263P probably benign Het
Obscn T C 11: 59,069,172 T3566A probably benign Het
Olfr1287 A T 2: 111,449,605 H155L probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr243 A T 7: 103,716,705 Y37F probably benign Het
Olfr761 T C 17: 37,952,898 N42S probably damaging Het
Opn5 A T 17: 42,611,238 F24L probably damaging Het
Palmd A G 3: 116,924,224 V208A probably damaging Het
Plekhd1 T A 12: 80,722,021 I426N possibly damaging Het
Polq T G 16: 37,061,082 Y1203D probably benign Het
Prex1 A G 2: 166,573,223 F251S probably damaging Het
Prkd3 T C 17: 78,952,727 M816V probably null Het
Rab3gap2 C T 1: 185,267,155 probably benign Het
Rcan2 C A 17: 44,037,081 P13Q probably damaging Het
Slc35b3 A G 13: 38,932,890 V329A probably benign Het
Slc5a1 T C 5: 33,160,902 M633T probably benign Het
Stac2 A C 11: 98,043,548 L110R possibly damaging Het
Tecpr1 T C 5: 144,217,257 E126G probably damaging Het
Ttll6 A G 11: 96,138,789 D176G possibly damaging Het
Utrn C T 10: 12,861,567 probably null Het
Zfp341 T C 2: 154,638,030 V467A probably damaging Het
Other mutations in Kcnc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Kcnc3 APN 7 44595386 missense probably damaging 1.00
IGL01607:Kcnc3 APN 7 44591304 missense probably damaging 1.00
IGL02397:Kcnc3 APN 7 44595794 missense probably damaging 1.00
IGL02807:Kcnc3 APN 7 44595957 missense probably damaging 1.00
IGL02961:Kcnc3 APN 7 44591492 missense probably damaging 0.99
elfen UTSW 7 44591296 frame shift probably null
Le_fitness UTSW 7 44595182 missense possibly damaging 0.92
Svelte UTSW 7 44595816 missense probably damaging 1.00
Trim UTSW 7 44595603 missense probably damaging 1.00
R0514:Kcnc3 UTSW 7 44595928 nonsense probably null
R0827:Kcnc3 UTSW 7 44595206 missense probably damaging 0.99
R1514:Kcnc3 UTSW 7 44595603 missense probably damaging 1.00
R2875:Kcnc3 UTSW 7 44591537 nonsense probably null
R4597:Kcnc3 UTSW 7 44595816 missense probably damaging 1.00
R4954:Kcnc3 UTSW 7 44591296 frame shift probably null
R6012:Kcnc3 UTSW 7 44598872 missense probably benign 0.26
R6093:Kcnc3 UTSW 7 44591508 missense probably benign 0.44
R6488:Kcnc3 UTSW 7 44595182 missense possibly damaging 0.92
R7542:Kcnc3 UTSW 7 44595714 missense possibly damaging 0.84
R7595:Kcnc3 UTSW 7 44591469 missense probably damaging 1.00
R7909:Kcnc3 UTSW 7 44595687 missense probably damaging 1.00
R7990:Kcnc3 UTSW 7 44595687 missense probably damaging 1.00
Z1177:Kcnc3 UTSW 7 44596106 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCAGTTCAGTGTGCGTC -3'
(R):5'- TCGAAAGAGTCCAGTGCCTC -3'

Sequencing Primer
(F):5'- AGCAGTGCTCTCAGCCC -3'
(R):5'- GAAAGAGTCCAGTGCCTCCTCAG -3'
Posted On2016-04-27