Incidental Mutation 'R4955:Palmd'
ID381522
Institutional Source Beutler Lab
Gene Symbol Palmd
Ensembl Gene ENSMUSG00000033377
Gene Namepalmdelphin
Synonyms4631423C22Rik, PALML
MMRRC Submission 042552-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R4955 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location116918258-116968987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116924224 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 208 (V208A)
Ref Sequence ENSEMBL: ENSMUSP00000113107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040097] [ENSMUST00000119557] [ENSMUST00000143611]
Predicted Effect probably damaging
Transcript: ENSMUST00000040097
AA Change: V208A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044693
Gene: ENSMUSG00000033377
AA Change: V208A

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:Paralemmin 65 512 3.6e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119557
AA Change: V208A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113107
Gene: ENSMUSG00000033377
AA Change: V208A

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:Paralemmin 64 278 6.6e-14 PFAM
Pfam:Paralemmin 323 515 1.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143611
SMART Domains Protein: ENSMUSP00000122725
Gene: ENSMUSG00000033377

DomainStartEndE-ValueType
coiled coil region 4 94 N/A INTRINSIC
Meta Mutation Damage Score 0.6565 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4933407L21Rik T A 1: 85,931,287 probably benign Het
Abca8a T G 11: 110,036,512 E1338D probably benign Het
Arl2bp G A 8: 94,670,428 probably null Het
Arsj T C 3: 126,438,540 Y312H probably benign Het
Atp8b2 G T 3: 89,952,920 probably benign Het
Cdh20 T C 1: 104,984,803 V594A probably damaging Het
Cfap44 T A 16: 44,475,277 V1646E possibly damaging Het
Csmd3 A T 15: 48,673,518 I96K probably damaging Het
Dusp27 T C 1: 166,108,092 Y179C probably damaging Het
Fbn2 T C 18: 58,058,383 Q1556R possibly damaging Het
Fstl5 T A 3: 76,223,876 probably null Het
Hist1h4i T A 13: 22,041,185 I47F probably damaging Het
Hivep2 T A 10: 14,130,958 M1100K probably benign Het
Ing4 C T 6: 125,048,201 A225V probably damaging Het
Kcnc3 CTT CT 7: 44,591,296 probably null Het
Khdrbs2 T A 1: 32,520,077 probably benign Het
Kif21a A T 15: 90,937,190 W1566R probably damaging Het
Lrfn5 A C 12: 61,839,978 D184A probably benign Het
Mettl2 C T 11: 105,137,779 T319I possibly damaging Het
Mgrn1 T C 16: 4,934,219 V529A probably benign Het
Naca T A 10: 128,042,215 probably benign Het
Ninj2 A G 6: 120,197,946 N26S probably damaging Het
Nqo1 A G 8: 107,388,857 S263P probably benign Het
Obscn T C 11: 59,069,172 T3566A probably benign Het
Olfr1287 A T 2: 111,449,605 H155L probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr243 A T 7: 103,716,705 Y37F probably benign Het
Olfr761 T C 17: 37,952,898 N42S probably damaging Het
Opn5 A T 17: 42,611,238 F24L probably damaging Het
Plekhd1 T A 12: 80,722,021 I426N possibly damaging Het
Polq T G 16: 37,061,082 Y1203D probably benign Het
Prex1 A G 2: 166,573,223 F251S probably damaging Het
Prkd3 T C 17: 78,952,727 M816V probably null Het
Rab3gap2 C T 1: 185,267,155 probably benign Het
Rcan2 C A 17: 44,037,081 P13Q probably damaging Het
Slc35b3 A G 13: 38,932,890 V329A probably benign Het
Slc5a1 T C 5: 33,160,902 M633T probably benign Het
Stac2 A C 11: 98,043,548 L110R possibly damaging Het
Tecpr1 T C 5: 144,217,257 E126G probably damaging Het
Ttll6 A G 11: 96,138,789 D176G possibly damaging Het
Utrn C T 10: 12,861,567 probably null Het
Zfp341 T C 2: 154,638,030 V467A probably damaging Het
Other mutations in Palmd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Palmd APN 3 116927391 splice site probably benign
IGL01112:Palmd APN 3 116924273 missense probably damaging 1.00
IGL01484:Palmd APN 3 116953145 splice site probably benign
IGL01527:Palmd APN 3 116927188 nonsense probably null
IGL01561:Palmd APN 3 116924093 missense probably damaging 0.99
IGL01975:Palmd APN 3 116923634 missense probably benign 0.24
R0107:Palmd UTSW 3 116924076 missense probably damaging 1.00
R1099:Palmd UTSW 3 116923225 missense possibly damaging 0.71
R1552:Palmd UTSW 3 116948040 splice site probably benign
R1613:Palmd UTSW 3 116923504 missense probably damaging 1.00
R1710:Palmd UTSW 3 116923657 missense probably damaging 1.00
R2090:Palmd UTSW 3 116927434 missense probably damaging 1.00
R2869:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2869:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2870:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2870:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2871:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2871:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2872:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2872:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2873:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R3774:Palmd UTSW 3 116927663 missense probably damaging 1.00
R3981:Palmd UTSW 3 116923823 missense probably benign 0.01
R3982:Palmd UTSW 3 116923823 missense probably benign 0.01
R3983:Palmd UTSW 3 116923823 missense probably benign 0.01
R5103:Palmd UTSW 3 116927421 missense probably damaging 1.00
R5261:Palmd UTSW 3 116923360 missense probably benign 0.04
R5265:Palmd UTSW 3 116923849 missense possibly damaging 0.67
R5292:Palmd UTSW 3 116923744 missense probably benign 0.00
R5499:Palmd UTSW 3 116923832 missense probably benign 0.01
R5597:Palmd UTSW 3 116923576 missense probably damaging 1.00
R5666:Palmd UTSW 3 116924101 missense possibly damaging 0.55
R5817:Palmd UTSW 3 116918623 missense probably benign 0.01
R6843:Palmd UTSW 3 116924215 missense probably damaging 1.00
R6854:Palmd UTSW 3 116923463 missense probably benign 0.06
R7052:Palmd UTSW 3 116923363 missense probably benign 0.30
R7450:Palmd UTSW 3 116927643 missense probably damaging 1.00
Z1177:Palmd UTSW 3 116923502 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGGATTGGCGTACACTGG -3'
(R):5'- AATCAGGACGATTTGTGGGG -3'

Sequencing Primer
(F):5'- CGTACACTGGCTCATGGTAC -3'
(R):5'- CCTAGAACTTGCTCTGTAGGACAGG -3'
Posted On2016-04-27